Incidental Mutation 'R6929:Pik3c2g'
ID 539898
Institutional Source Beutler Lab
Gene Symbol Pik3c2g
Ensembl Gene ENSMUSG00000030228
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Synonyms
MMRRC Submission 045007-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R6929 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 139591070-139915010 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 139903502 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 585 (R585Q)
Ref Sequence ENSEMBL: ENSMUSP00000084939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000087657
AA Change: R585Q

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228
AA Change: R585Q

DomainStartEndE-ValueType
PI3Kc 125 387 2.11e-109 SMART
PX 411 515 1.24e-21 SMART
C2 550 647 1.34e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000111868
AA Change: R953Q
SMART Domains Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: R953Q

DomainStartEndE-ValueType
SCOP:d1e8xa2 1 83 4e-16 SMART
PI3Ka 103 288 7.6e-29 SMART
PI3Kc 375 637 2.11e-109 SMART
PX 661 765 1.24e-21 SMART
C2 800 897 1.34e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000218528
AA Change: R835Q

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A T 2: 26,896,275 (GRCm39) R1223* probably null Het
Adgrb3 A T 1: 25,150,852 (GRCm39) L1127* probably null Het
Ankrd17 A T 5: 90,433,384 (GRCm39) V727D possibly damaging Het
Ankub1 A T 3: 57,572,854 (GRCm39) C289* probably null Het
C2 T A 17: 35,083,323 (GRCm39) I242F possibly damaging Het
C2cd3 T C 7: 100,100,826 (GRCm39) L653P probably damaging Het
Cacna1b A G 2: 24,522,022 (GRCm39) V1696A probably damaging Het
Cep295 A G 9: 15,244,358 (GRCm39) I1366T probably damaging Het
Chd9 T C 8: 91,769,573 (GRCm39) L2553P probably damaging Het
Cited4 C A 4: 120,524,244 (GRCm39) T82K probably benign Het
Dnah6 A T 6: 73,021,756 (GRCm39) M3470K probably damaging Het
Exosc3 G T 4: 45,320,482 (GRCm39) P37Q probably damaging Het
Fam120b C A 17: 15,643,290 (GRCm39) Q690K possibly damaging Het
Fyb1 T C 15: 6,668,388 (GRCm39) I527T probably damaging Het
Gm32742 A G 9: 51,065,579 (GRCm39) L459P probably benign Het
Gm45861 A G 8: 28,014,462 (GRCm39) D655G unknown Het
Ifi203 A G 1: 173,756,340 (GRCm39) probably benign Het
Ifnar2 T A 16: 91,190,766 (GRCm39) L93* probably null Het
Kdr A G 5: 76,138,764 (GRCm39) V22A probably benign Het
Llgl1 C T 11: 60,601,179 (GRCm39) Q706* probably null Het
Lrrc9 A T 12: 72,497,546 (GRCm39) K121N probably benign Het
Lyst T C 13: 13,917,909 (GRCm39) F3323S probably damaging Het
Mc4r A G 18: 66,992,253 (GRCm39) Y287H probably damaging Het
Nlrp4e A C 7: 23,036,156 (GRCm39) probably null Het
Or52z12 A T 7: 103,233,651 (GRCm39) I141F probably damaging Het
Or8b42 A G 9: 38,342,444 (GRCm39) I289V probably benign Het
Pear1 T A 3: 87,666,872 (GRCm39) K38* probably null Het
Prpf40a A G 2: 53,034,875 (GRCm39) V771A possibly damaging Het
Rnd3 G T 2: 51,027,187 (GRCm39) D103E probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Spats2l A T 1: 57,918,695 (GRCm39) N43I probably damaging Het
Tmem202 C A 9: 59,426,504 (GRCm39) G221C probably benign Het
Ubiad1 T C 4: 148,528,579 (GRCm39) D110G probably damaging Het
Ulk4 A T 9: 120,903,081 (GRCm39) V1132D probably benign Het
Vmn2r118 C T 17: 55,917,440 (GRCm39) M357I probably benign Het
Zfp663 G C 2: 165,195,178 (GRCm39) P347R probably benign Het
Other mutations in Pik3c2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Pik3c2g APN 6 139,841,851 (GRCm39) missense probably damaging 1.00
IGL01355:Pik3c2g APN 6 139,798,583 (GRCm39) missense probably damaging 0.98
IGL01579:Pik3c2g APN 6 139,700,467 (GRCm39) nonsense probably null
IGL01580:Pik3c2g APN 6 139,599,514 (GRCm39) missense probably damaging 0.99
IGL01587:Pik3c2g APN 6 139,700,467 (GRCm39) nonsense probably null
IGL01813:Pik3c2g APN 6 139,599,407 (GRCm39) missense possibly damaging 0.55
IGL02218:Pik3c2g APN 6 139,806,081 (GRCm39) missense probably damaging 1.00
IGL02479:Pik3c2g APN 6 139,863,730 (GRCm39) missense probably benign 0.40
IGL02480:Pik3c2g APN 6 139,798,526 (GRCm39) missense probably damaging 1.00
IGL02721:Pik3c2g APN 6 139,682,699 (GRCm39) missense probably benign 0.15
IGL02967:Pik3c2g APN 6 139,913,554 (GRCm39) missense probably damaging 0.98
IGL03221:Pik3c2g APN 6 139,718,133 (GRCm39) critical splice acceptor site probably null
FR4304:Pik3c2g UTSW 6 139,612,654 (GRCm39) frame shift probably null
FR4340:Pik3c2g UTSW 6 139,612,654 (GRCm39) frame shift probably null
FR4976:Pik3c2g UTSW 6 139,612,652 (GRCm39) frame shift probably null
IGL02837:Pik3c2g UTSW 6 139,603,562 (GRCm39) nonsense probably null
PIT4531001:Pik3c2g UTSW 6 139,805,096 (GRCm39) missense
R0002:Pik3c2g UTSW 6 139,714,471 (GRCm39) missense probably benign 0.08
R0081:Pik3c2g UTSW 6 139,903,519 (GRCm39) missense probably benign 0.05
R0098:Pik3c2g UTSW 6 139,639,441 (GRCm39) missense unknown
R0719:Pik3c2g UTSW 6 139,606,723 (GRCm39) missense probably damaging 1.00
R0740:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R0837:Pik3c2g UTSW 6 139,903,425 (GRCm39) splice site probably benign
R0840:Pik3c2g UTSW 6 139,841,798 (GRCm39) missense probably damaging 1.00
R1306:Pik3c2g UTSW 6 139,718,154 (GRCm39) missense probably benign
R1501:Pik3c2g UTSW 6 139,789,796 (GRCm39) critical splice donor site probably null
R1591:Pik3c2g UTSW 6 139,693,904 (GRCm39) missense probably benign 0.00
R1666:Pik3c2g UTSW 6 139,612,634 (GRCm39) intron probably benign
R1907:Pik3c2g UTSW 6 139,789,768 (GRCm39) missense probably damaging 1.00
R1970:Pik3c2g UTSW 6 139,846,112 (GRCm39) critical splice donor site probably null
R1982:Pik3c2g UTSW 6 139,599,546 (GRCm39) missense probably damaging 0.97
R2171:Pik3c2g UTSW 6 139,801,012 (GRCm39) nonsense probably null
R2188:Pik3c2g UTSW 6 139,798,600 (GRCm39) missense probably damaging 1.00
R3777:Pik3c2g UTSW 6 139,599,385 (GRCm39) missense probably damaging 1.00
R3778:Pik3c2g UTSW 6 139,599,385 (GRCm39) missense probably damaging 1.00
R3965:Pik3c2g UTSW 6 139,801,018 (GRCm39) missense possibly damaging 0.90
R4076:Pik3c2g UTSW 6 139,798,589 (GRCm39) missense probably damaging 1.00
R4078:Pik3c2g UTSW 6 139,612,608 (GRCm39) intron probably benign
R4108:Pik3c2g UTSW 6 139,676,096 (GRCm39) missense probably benign 0.00
R4461:Pik3c2g UTSW 6 139,787,407 (GRCm39) intron probably benign
R4474:Pik3c2g UTSW 6 139,610,749 (GRCm39) missense probably damaging 0.99
R4509:Pik3c2g UTSW 6 139,665,732 (GRCm39) missense probably benign 0.25
R4646:Pik3c2g UTSW 6 139,665,744 (GRCm39) missense probably benign 0.05
R4732:Pik3c2g UTSW 6 139,881,711 (GRCm39) missense probably benign 0.28
R4733:Pik3c2g UTSW 6 139,881,711 (GRCm39) missense probably benign 0.28
R4854:Pik3c2g UTSW 6 139,714,505 (GRCm39) missense probably damaging 1.00
R4928:Pik3c2g UTSW 6 139,913,528 (GRCm39) missense possibly damaging 0.88
R4959:Pik3c2g UTSW 6 139,789,657 (GRCm39) missense possibly damaging 0.65
R4973:Pik3c2g UTSW 6 139,789,657 (GRCm39) missense possibly damaging 0.65
R5032:Pik3c2g UTSW 6 139,841,928 (GRCm39) missense probably benign 0.00
R5071:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5072:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5073:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5074:Pik3c2g UTSW 6 139,665,873 (GRCm39) missense probably null 0.00
R5107:Pik3c2g UTSW 6 139,612,623 (GRCm39) intron probably benign
R5186:Pik3c2g UTSW 6 139,599,016 (GRCm39) missense probably damaging 1.00
R5253:Pik3c2g UTSW 6 139,841,983 (GRCm39) critical splice donor site probably null
R5359:Pik3c2g UTSW 6 139,599,121 (GRCm39) missense probably damaging 1.00
R5394:Pik3c2g UTSW 6 139,665,808 (GRCm39) missense probably benign
R5417:Pik3c2g UTSW 6 139,682,669 (GRCm39) missense probably benign
R5435:Pik3c2g UTSW 6 139,661,581 (GRCm39) splice site probably null
R5580:Pik3c2g UTSW 6 139,603,531 (GRCm39) missense probably damaging 0.99
R5664:Pik3c2g UTSW 6 139,682,733 (GRCm39) missense probably damaging 0.98
R5908:Pik3c2g UTSW 6 139,714,436 (GRCm39) missense
R5914:Pik3c2g UTSW 6 139,599,477 (GRCm39) missense probably benign 0.00
R6046:Pik3c2g UTSW 6 139,842,518 (GRCm39) missense probably damaging 1.00
R6046:Pik3c2g UTSW 6 139,599,137 (GRCm39) missense probably damaging 0.96
R6298:Pik3c2g UTSW 6 139,603,561 (GRCm39) missense probably damaging 1.00
R6382:Pik3c2g UTSW 6 139,665,724 (GRCm39) missense possibly damaging 0.88
R6480:Pik3c2g UTSW 6 139,676,195 (GRCm39) missense probably benign 0.27
R6917:Pik3c2g UTSW 6 139,841,899 (GRCm39) missense probably benign 0.00
R7022:Pik3c2g UTSW 6 139,599,061 (GRCm39) missense possibly damaging 0.82
R7144:Pik3c2g UTSW 6 139,606,868 (GRCm39) missense probably damaging 1.00
R7213:Pik3c2g UTSW 6 139,805,990 (GRCm39) missense
R7215:Pik3c2g UTSW 6 139,700,589 (GRCm39) missense
R7332:Pik3c2g UTSW 6 139,841,981 (GRCm39) missense
R7357:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R7359:Pik3c2g UTSW 6 139,913,620 (GRCm39) missense unknown
R7385:Pik3c2g UTSW 6 139,801,079 (GRCm39) missense
R7455:Pik3c2g UTSW 6 139,913,643 (GRCm39) missense unknown
R7651:Pik3c2g UTSW 6 139,599,070 (GRCm39) missense possibly damaging 0.85
R7888:Pik3c2g UTSW 6 139,842,470 (GRCm39) missense
R7923:Pik3c2g UTSW 6 139,610,791 (GRCm39) critical splice donor site probably null
R7964:Pik3c2g UTSW 6 139,827,786 (GRCm39) missense
R8005:Pik3c2g UTSW 6 139,599,067 (GRCm39) missense probably benign 0.01
R8371:Pik3c2g UTSW 6 139,881,782 (GRCm39) missense unknown
R8724:Pik3c2g UTSW 6 139,913,619 (GRCm39) missense unknown
R8733:Pik3c2g UTSW 6 139,714,426 (GRCm39) nonsense probably null
R8809:Pik3c2g UTSW 6 139,714,436 (GRCm39) missense
R8888:Pik3c2g UTSW 6 139,676,092 (GRCm39) nonsense probably null
R8931:Pik3c2g UTSW 6 139,821,093 (GRCm39) missense probably benign 0.02
R9188:Pik3c2g UTSW 6 139,599,401 (GRCm39) missense possibly damaging 0.94
R9336:Pik3c2g UTSW 6 139,821,161 (GRCm39) missense
R9383:Pik3c2g UTSW 6 139,827,742 (GRCm39) nonsense probably null
R9524:Pik3c2g UTSW 6 139,606,768 (GRCm39) missense probably damaging 0.99
R9531:Pik3c2g UTSW 6 139,841,926 (GRCm39) missense
R9630:Pik3c2g UTSW 6 139,599,237 (GRCm39) missense possibly damaging 0.66
R9697:Pik3c2g UTSW 6 139,913,517 (GRCm39) missense unknown
R9708:Pik3c2g UTSW 6 139,606,865 (GRCm39) missense probably benign
R9717:Pik3c2g UTSW 6 139,841,910 (GRCm39) missense
RF015:Pik3c2g UTSW 6 139,700,497 (GRCm39) missense
RF032:Pik3c2g UTSW 6 139,612,656 (GRCm39) frame shift probably null
X0024:Pik3c2g UTSW 6 139,805,984 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTTTCATAACTCCAGATCC -3'
(R):5'- GCTGGTACTATTTTGGGCAAC -3'

Sequencing Primer
(F):5'- AGATCCTGCCTCTGGTCTGG -3'
(R):5'- GGTACTATTTTGGGCAACATCATGC -3'
Posted On 2018-11-06