Mutagenetix > Incidental Mutations

Incidental Mutation 'R6929:C2cd3'

539900

Institutional Source

Beutler Lab

Gene Symbol

C2cd3

Ensembl Gene

ENSMUSG00000047248

Gene Name

C2 calcium-dependent domain containing 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6929 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100372233-100470152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100451619 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 653 (L653P)

Ref Sequence

ENSEMBL: ENSMUSP00000113728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]

Predicted Effect

probably damaging
Transcript: ENSMUST00000051777
AA Change: L1884P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: L1884P

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098259
AA Change: L1884P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: L1884P

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: L1506P

Domain	Start	End	E-Value	Type
C2	61	199	2.36e1	SMART
C2	327	436	3.73e0	SMART
C2	526	666	1.47e1	SMART
C2	719	858	1.63e1	SMART
C2	1154	1261	1.43e-2	SMART
low complexity region	1429	1443	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120196
AA Change: L653P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248
AA Change: L653P

Domain	Start	End	E-Value	Type
low complexity region	297	308	N/A	INTRINSIC
C2	415	553	1.5e-1	SMART
C2	681	790	2.4e-2	SMART
C2	880	1020	9.5e-2	SMART
C2	1073	1212	1.1e-1	SMART
C2	1508	1615	9e-5	SMART
low complexity region	1783	1797	N/A	INTRINSIC
low complexity region	1928	1940	N/A	INTRINSIC
low complexity region	2001	2016	N/A	INTRINSIC
low complexity region	2071	2087	N/A	INTRINSIC

Predicted Effect

Meta Mutation Damage Score

0.6619

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.4%

Validation Efficiency

92% (35/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts13	A	T	2: 27,006,263	R1223*	probably null	Het
Adgrb3	A	T	1: 25,111,771	L1127*	probably null	Het
Ankrd17	A	T	5: 90,285,525	V727D	possibly damaging	Het
Ankub1	A	T	3: 57,665,433	C289*	probably null	Het
C2	T	A	17: 34,864,347	I242F	possibly damaging	Het
Cacna1b	A	G	2: 24,632,010	V1696A	probably damaging	Het
Cep295	A	G	9: 15,333,062	I1366T	probably damaging	Het
Chd9	T	C	8: 91,042,945	L2553P	probably damaging	Het
Cited4	C	A	4: 120,667,047	T82K	probably benign	Het
Dnah6	A	T	6: 73,044,773	M3470K	probably damaging	Het
Exosc3	G	T	4: 45,320,482	P37Q	probably damaging	Het
Fam120b	C	A	17: 15,423,028	Q690K	possibly damaging	Het
Fyb	T	C	15: 6,638,907	I527T	probably damaging	Het
Gm32742	A	G	9: 51,154,279	L459P	probably benign	Het
Gm45861	A	G	8: 27,524,434	D655G	unknown	Het
Ifi203	A	G	1: 173,928,774		probably benign	Het
Ifnar2	T	A	16: 91,393,878	L93*	probably null	Het
Kdr	A	G	5: 75,978,104	V22A	probably benign	Het
Llgl1	C	T	11: 60,710,353	Q706*	probably null	Het
Lrrc9	A	T	12: 72,450,772	K121N	probably benign	Het
Lyst	T	C	13: 13,743,324	F3323S	probably damaging	Het
Mc4r	A	G	18: 66,859,182	Y287H	probably damaging	Het
Nlrp4e	A	C	7: 23,336,731		probably null	Het
Olfr617	A	T	7: 103,584,444	I141F	probably damaging	Het
Olfr901	A	G	9: 38,431,148	I289V	probably benign	Het
Pear1	T	A	3: 87,759,565	K38*	probably null	Het
Pik3c2g	G	A	6: 139,957,776	R585Q	possibly damaging	Het
Prpf40a	A	G	2: 53,144,863	V771A	possibly damaging	Het
Rnd3	G	T	2: 51,137,175	D103E	probably damaging	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 127,021,626		probably benign	Het
Spats2l	A	T	1: 57,879,536	N43I	probably damaging	Het
Tmem202	C	A	9: 59,519,221	G221C	probably benign	Het
Ubiad1	T	C	4: 148,444,122	D110G	probably damaging	Het
Ulk4	A	T	9: 121,074,015	V1132D	probably benign	Het
Vmn2r118	C	T	17: 55,610,440	M357I	probably benign	Het
Zfp663	G	C	2: 165,353,258	P347R	probably benign	Het

Other mutations in C2cd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:C2cd3	APN	7	100391128	missense	probably benign	0.14
IGL01420:C2cd3	APN	7	100454858	missense	probably benign	0.35
IGL01775:C2cd3	APN	7	100443431	missense	probably damaging	1.00
IGL01832:C2cd3	APN	7	100427214	missense	possibly damaging	0.94
IGL01883:C2cd3	APN	7	100374486	missense	possibly damaging	0.80
IGL02664:C2cd3	APN	7	100419715	missense	possibly damaging	0.67
IGL02697:C2cd3	APN	7	100427169	unclassified	probably benign
IGL02852:C2cd3	APN	7	100430189	missense	probably damaging	1.00
IGL03158:C2cd3	APN	7	100374476	missense	probably damaging	1.00
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0124:C2cd3	UTSW	7	100469518	missense	probably benign
R0387:C2cd3	UTSW	7	100422507	splice site	probably benign
R0522:C2cd3	UTSW	7	100395222	missense	probably benign	0.14
R1124:C2cd3	UTSW	7	100422681	missense	probably benign	0.00
R1484:C2cd3	UTSW	7	100440190	missense	probably damaging	1.00
R1533:C2cd3	UTSW	7	100406077	missense	possibly damaging	0.54
R1631:C2cd3	UTSW	7	100372497	critical splice donor site	probably null
R1875:C2cd3	UTSW	7	100407025	missense	possibly damaging	0.89
R2059:C2cd3	UTSW	7	100455493	unclassified	probably benign
R2060:C2cd3	UTSW	7	100454948	missense	probably damaging	1.00
R2348:C2cd3	UTSW	7	100413366	missense	probably damaging	1.00
R3103:C2cd3	UTSW	7	100395252	missense	possibly damaging	0.47
R3405:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R3687:C2cd3	UTSW	7	100435833	missense	probably benign	0.28
R3775:C2cd3	UTSW	7	100431998	missense	probably damaging	1.00
R3854:C2cd3	UTSW	7	100454601	critical splice acceptor site	probably null
R4359:C2cd3	UTSW	7	100441089	missense	probably damaging	1.00
R4403:C2cd3	UTSW	7	100432099	missense	probably damaging	1.00
R4446:C2cd3	UTSW	7	100374477	missense	probably damaging	1.00
R4646:C2cd3	UTSW	7	100372450	unclassified	probably benign
R4705:C2cd3	UTSW	7	100395188	missense	possibly damaging	0.77
R4770:C2cd3	UTSW	7	100443435	missense	probably damaging	1.00
R4777:C2cd3	UTSW	7	100416332	missense	possibly damaging	0.46
R4816:C2cd3	UTSW	7	100391019	missense	probably benign	0.01
R4842:C2cd3	UTSW	7	100416190	missense	probably benign	0.00
R4858:C2cd3	UTSW	7	100454953	missense	probably damaging	1.00
R4871:C2cd3	UTSW	7	100413374	missense	possibly damaging	0.79
R4898:C2cd3	UTSW	7	100405959	missense	probably damaging	1.00
R5026:C2cd3	UTSW	7	100459842	missense	possibly damaging	0.52
R5112:C2cd3	UTSW	7	100443485	missense	possibly damaging	0.91
R5242:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R5538:C2cd3	UTSW	7	100455493	critical splice donor site	probably null
R5861:C2cd3	UTSW	7	100444475	unclassified	probably benign
R6110:C2cd3	UTSW	7	100441076	missense	probably damaging	1.00
R6326:C2cd3	UTSW	7	100416428	missense	probably benign	0.02
R6429:C2cd3	UTSW	7	100432091	missense	probably damaging	1.00
R6610:C2cd3	UTSW	7	100455298	missense	probably benign
R6613:C2cd3	UTSW	7	100395241	missense	possibly damaging	0.87
R6631:C2cd3	UTSW	7	100418540	missense	probably damaging	1.00
R6787:C2cd3	UTSW	7	100455346	missense	probably benign
R6837:C2cd3	UTSW	7	100448746	missense	probably damaging	1.00
R6849:C2cd3	UTSW	7	100406927	missense	probably damaging	1.00
R6860:C2cd3	UTSW	7	100390241	missense	probably benign	0.28
R7026:C2cd3	UTSW	7	100432092	missense	probably damaging	1.00
R7088:C2cd3	UTSW	7	100416181	missense
R7174:C2cd3	UTSW	7	100432198	missense
R7241:C2cd3	UTSW	7	100407050	missense
R7335:C2cd3	UTSW	7	100422603	missense
R7357:C2cd3	UTSW	7	100430103	missense
R7493:C2cd3	UTSW	7	100427226	missense
R7567:C2cd3	UTSW	7	100430815	missense
R7573:C2cd3	UTSW	7	100419707	missense
R7869:C2cd3	UTSW	7	100469491	missense	probably damaging	0.99
R7999:C2cd3	UTSW	7	100459889	critical splice donor site	probably null
R8134:C2cd3	UTSW	7	100418504	missense
R8369:C2cd3	UTSW	7	100395258	missense	probably benign	0.03
R8372:C2cd3	UTSW	7	100455280	nonsense	probably null
X0002:C2cd3	UTSW	7	100440235	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- GACAAAGTTGGGTCTGGCAG -3'
(R):5'- AGCTGTACCTGAGATCAAGGAGC -3'

Sequencing Primer
(F):5'- TAAATGGCAGGTGGAAGAGAATAG -3'
(R):5'- TCAAGGAGCTGACTTGCGAC -3'

Posted On

2018-11-06