Incidental Mutation 'R6929:Tmem202'
ID539907
Institutional Source Beutler Lab
Gene Symbol Tmem202
Ensembl Gene ENSMUSG00000049526
Gene Nametransmembrane protein 202
Synonyms4930425N13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6929 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location59518685-59539847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59519221 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 221 (G221C)
Ref Sequence ENSEMBL: ENSMUSP00000053782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055345]
Predicted Effect probably benign
Transcript: ENSMUST00000055345
AA Change: G221C

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000053782
Gene: ENSMUSG00000049526
AA Change: G221C

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 50 206 2.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A T 2: 27,006,263 R1223* probably null Het
Adgrb3 A T 1: 25,111,771 L1127* probably null Het
Ankrd17 A T 5: 90,285,525 V727D possibly damaging Het
Ankub1 A T 3: 57,665,433 C289* probably null Het
C2 T A 17: 34,864,347 I242F possibly damaging Het
C2cd3 T C 7: 100,451,619 L653P probably damaging Het
Cacna1b A G 2: 24,632,010 V1696A probably damaging Het
Cep295 A G 9: 15,333,062 I1366T probably damaging Het
Chd9 T C 8: 91,042,945 L2553P probably damaging Het
Cited4 C A 4: 120,667,047 T82K probably benign Het
Dnah6 A T 6: 73,044,773 M3470K probably damaging Het
Exosc3 G T 4: 45,320,482 P37Q probably damaging Het
Fam120b C A 17: 15,423,028 Q690K possibly damaging Het
Fyb T C 15: 6,638,907 I527T probably damaging Het
Gm32742 A G 9: 51,154,279 L459P probably benign Het
Gm45861 A G 8: 27,524,434 D655G unknown Het
Ifi203 A G 1: 173,928,774 probably benign Het
Ifnar2 T A 16: 91,393,878 L93* probably null Het
Kdr A G 5: 75,978,104 V22A probably benign Het
Llgl1 C T 11: 60,710,353 Q706* probably null Het
Lrrc9 A T 12: 72,450,772 K121N probably benign Het
Lyst T C 13: 13,743,324 F3323S probably damaging Het
Mc4r A G 18: 66,859,182 Y287H probably damaging Het
Nlrp4e A C 7: 23,336,731 probably null Het
Olfr617 A T 7: 103,584,444 I141F probably damaging Het
Olfr901 A G 9: 38,431,148 I289V probably benign Het
Pear1 T A 3: 87,759,565 K38* probably null Het
Pik3c2g G A 6: 139,957,776 R585Q possibly damaging Het
Prpf40a A G 2: 53,144,863 V771A possibly damaging Het
Rnd3 G T 2: 51,137,175 D103E probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Spats2l A T 1: 57,879,536 N43I probably damaging Het
Ubiad1 T C 4: 148,444,122 D110G probably damaging Het
Ulk4 A T 9: 121,074,015 V1132D probably benign Het
Vmn2r118 C T 17: 55,610,440 M357I probably benign Het
Zfp663 G C 2: 165,353,258 P347R probably benign Het
Other mutations in Tmem202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03344:Tmem202 APN 9 59519068 missense possibly damaging 0.53
R0011:Tmem202 UTSW 9 59524801 missense probably benign 0.00
R0011:Tmem202 UTSW 9 59524801 missense probably benign 0.00
R0711:Tmem202 UTSW 9 59525372 missense probably damaging 0.99
R1690:Tmem202 UTSW 9 59519108 missense possibly damaging 0.93
R2127:Tmem202 UTSW 9 59520200 missense probably benign 0.41
R4747:Tmem202 UTSW 9 59519194 missense possibly damaging 0.47
R4998:Tmem202 UTSW 9 59524846 missense probably damaging 0.99
R6916:Tmem202 UTSW 9 59525474 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCAAATTTAGCCTTCTGTCATCC -3'
(R):5'- GTGGGAAAGCATAGATTTGGTAATC -3'

Sequencing Primer
(F):5'- AGCCTTCTGTCATCCTATCACAG -3'
(R):5'- AGCATAGATTTGGTAATCAAAAGCC -3'
Posted On2018-11-06