Mutagenetix > Incidental Mutations

Incidental Mutation 'R6929:Vmn2r118'

539916

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r118

Ensembl Gene

ENSMUSG00000091504

Gene Name

vomeronasal 2, receptor 118

Synonyms

EG383258, Vmn2r119, EG668547

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.211) question?

Stock #

R6929 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55592341-55624672 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 55610440 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 357 (M357I)

Ref Sequence

ENSEMBL: ENSMUSP00000131128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168440]

Predicted Effect

probably benign
Transcript: ENSMUST00000168440
AA Change: M357I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: M357I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	142	470	4.6e-27	PFAM
Pfam:NCD3G	513	566	2.6e-20	PFAM
Pfam:7tm_3	599	834	5.9e-55	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.4%

Validation Efficiency

92% (35/38)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts13	A	T	2: 27,006,263	R1223*	probably null	Het
Adgrb3	A	T	1: 25,111,771	L1127*	probably null	Het
Ankrd17	A	T	5: 90,285,525	V727D	possibly damaging	Het
Ankub1	A	T	3: 57,665,433	C289*	probably null	Het
C2	T	A	17: 34,864,347	I242F	possibly damaging	Het
C2cd3	T	C	7: 100,451,619	L653P	probably damaging	Het
Cacna1b	A	G	2: 24,632,010	V1696A	probably damaging	Het
Cep295	A	G	9: 15,333,062	I1366T	probably damaging	Het
Chd9	T	C	8: 91,042,945	L2553P	probably damaging	Het
Cited4	C	A	4: 120,667,047	T82K	probably benign	Het
Dnah6	A	T	6: 73,044,773	M3470K	probably damaging	Het
Exosc3	G	T	4: 45,320,482	P37Q	probably damaging	Het
Fam120b	C	A	17: 15,423,028	Q690K	possibly damaging	Het
Fyb	T	C	15: 6,638,907	I527T	probably damaging	Het
Gm32742	A	G	9: 51,154,279	L459P	probably benign	Het
Gm45861	A	G	8: 27,524,434	D655G	unknown	Het
Ifi203	A	G	1: 173,928,774		probably benign	Het
Ifnar2	T	A	16: 91,393,878	L93*	probably null	Het
Kdr	A	G	5: 75,978,104	V22A	probably benign	Het
Llgl1	C	T	11: 60,710,353	Q706*	probably null	Het
Lrrc9	A	T	12: 72,450,772	K121N	probably benign	Het
Lyst	T	C	13: 13,743,324	F3323S	probably damaging	Het
Mc4r	A	G	18: 66,859,182	Y287H	probably damaging	Het
Nlrp4e	A	C	7: 23,336,731		probably null	Het
Olfr617	A	T	7: 103,584,444	I141F	probably damaging	Het
Olfr901	A	G	9: 38,431,148	I289V	probably benign	Het
Pear1	T	A	3: 87,759,565	K38*	probably null	Het
Pik3c2g	G	A	6: 139,957,776	R585Q	possibly damaging	Het
Prpf40a	A	G	2: 53,144,863	V771A	possibly damaging	Het
Rnd3	G	T	2: 51,137,175	D103E	probably damaging	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 127,021,626		probably benign	Het
Spats2l	A	T	1: 57,879,536	N43I	probably damaging	Het
Tmem202	C	A	9: 59,519,221	G221C	probably benign	Het
Ubiad1	T	C	4: 148,444,122	D110G	probably damaging	Het
Ulk4	A	T	9: 121,074,015	V1132D	probably benign	Het
Zfp663	G	C	2: 165,353,258	P347R	probably benign	Het

Other mutations in Vmn2r118

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Vmn2r118	APN	17	55592708	missense	probably damaging	1.00
IGL00976:Vmn2r118	APN	17	55593204	missense	probably damaging	1.00
IGL01419:Vmn2r118	APN	17	55593000	missense	probably benign	0.01
IGL01796:Vmn2r118	APN	17	55608585	missense	probably benign	0.30
IGL01799:Vmn2r118	APN	17	55592990	missense	probably damaging	1.00
IGL02002:Vmn2r118	APN	17	55592619	missense	probably damaging	1.00
IGL02075:Vmn2r118	APN	17	55610517	missense	probably benign	0.18
IGL02172:Vmn2r118	APN	17	55624598	missense	probably benign	0.00
IGL02529:Vmn2r118	APN	17	55610870	missense	possibly damaging	0.58
IGL02712:Vmn2r118	APN	17	55592655	missense	probably benign	0.21
IGL03096:Vmn2r118	APN	17	55607996	missense	probably damaging	1.00
R0306:Vmn2r118	UTSW	17	55608616	missense	possibly damaging	0.89
R0329:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0330:Vmn2r118	UTSW	17	55610717	missense	probably damaging	1.00
R0396:Vmn2r118	UTSW	17	55608643	missense	probably benign	0.00
R0411:Vmn2r118	UTSW	17	55611021	splice site	probably benign
R0513:Vmn2r118	UTSW	17	55610970	nonsense	probably null
R0627:Vmn2r118	UTSW	17	55610772	missense	probably benign	0.01
R0638:Vmn2r118	UTSW	17	55608466	missense	probably benign	0.03
R1328:Vmn2r118	UTSW	17	55608620	missense	probably benign	0.01
R1366:Vmn2r118	UTSW	17	55593237	nonsense	probably null
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1465:Vmn2r118	UTSW	17	55610935	missense	probably benign	0.33
R1511:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R1515:Vmn2r118	UTSW	17	55610643	missense	probably benign	0.25
R1550:Vmn2r118	UTSW	17	55608083	missense	probably damaging	1.00
R1779:Vmn2r118	UTSW	17	55611530	missense	probably benign	0.03
R1834:Vmn2r118	UTSW	17	55592456	missense	probably damaging	1.00
R1840:Vmn2r118	UTSW	17	55610406	nonsense	probably null
R1854:Vmn2r118	UTSW	17	55611556	missense	possibly damaging	0.57
R1967:Vmn2r118	UTSW	17	55592882	missense	probably damaging	1.00
R1976:Vmn2r118	UTSW	17	55592925	missense	probably damaging	1.00
R2308:Vmn2r118	UTSW	17	55624650	missense	probably benign	0.33
R3700:Vmn2r118	UTSW	17	55608421	missense	possibly damaging	0.68
R4334:Vmn2r118	UTSW	17	55610347	missense	possibly damaging	0.58
R4647:Vmn2r118	UTSW	17	55610665	missense	probably damaging	1.00
R4709:Vmn2r118	UTSW	17	55610860	missense	probably damaging	1.00
R4805:Vmn2r118	UTSW	17	55592581	missense	probably damaging	1.00
R4858:Vmn2r118	UTSW	17	55592894	missense	probably damaging	0.98
R5384:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5385:Vmn2r118	UTSW	17	55611565	missense	probably benign	0.00
R5664:Vmn2r118	UTSW	17	55592765	missense	possibly damaging	0.46
R5740:Vmn2r118	UTSW	17	55593103	missense	probably benign	0.00
R5927:Vmn2r118	UTSW	17	55624494	missense	probably benign	0.04
R6143:Vmn2r118	UTSW	17	55592871	missense	possibly damaging	0.92
R6513:Vmn2r118	UTSW	17	55608093	missense	probably damaging	1.00
R6573:Vmn2r118	UTSW	17	55592996	missense	probably damaging	1.00
R6760:Vmn2r118	UTSW	17	55592714	missense	possibly damaging	0.92
R6794:Vmn2r118	UTSW	17	55592348	missense	possibly damaging	0.48
R7201:Vmn2r118	UTSW	17	55608496	nonsense	probably null
R7539:Vmn2r118	UTSW	17	55592853	missense	probably damaging	0.98
R7836:Vmn2r118	UTSW	17	55593242	missense	probably damaging	0.99
R8179:Vmn2r118	UTSW	17	55608484	missense	probably benign	0.36
R8248:Vmn2r118	UTSW	17	55610936	missense	probably benign	0.18
R8347:Vmn2r118	UTSW	17	55610423	missense	possibly damaging	0.94
R8415:Vmn2r118	UTSW	17	55608057	missense	probably benign	0.08
R8428:Vmn2r118	UTSW	17	55608642	missense	probably benign	0.33
X0022:Vmn2r118	UTSW	17	55593218	missense	probably damaging	1.00
Z1176:Vmn2r118	UTSW	17	55610655	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACTCCTGCATTAGTTGGGTCAC -3'
(R):5'- ACCTCACAATGGGATGCCATC -3'

Sequencing Primer
(F):5'- CATTAGTTGGGTCACATTTTCCAG -3'
(R):5'- GCCATCACAAGGGAGAAAGACTTC -3'

Posted On

2018-11-06