Mutagenetix > Incidental Mutations

Incidental Mutation 'R6930:Olfr220'

539922

Institutional Source

Beutler Lab

Gene Symbol

Olfr220

Ensembl Gene

ENSMUSG00000066671

Gene Name

olfactory receptor 220

Synonyms

EG546747, GA_x6K02SYWY4V-595-239, Olfr413-ps1, GA_x6K02T2P20D-20731742-20730694, MOR103-17, MOR103-13P

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R6930 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

174442082-174451277 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 174449111 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 163 (I163V)

Ref Sequence

ENSEMBL: ENSMUSP00000141919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085861] [ENSMUST00000194229]

Predicted Effect

probably damaging
Transcript: ENSMUST00000085861
AA Change: I163V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000083023
Gene: ENSMUSG00000066671
AA Change: I163V

Domain	Start	End	E-Value	Type
Pfam:7tm_4	36	314	1.2e-51	PFAM
Pfam:7tm_1	46	295	3.6e-25	PFAM
low complexity region	315	325	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000194229
AA Change: I163V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000141919
Gene: ENSMUSG00000066671
AA Change: I163V

Domain	Start	End	E-Value	Type
Pfam:7tm_1	46	295	6e-33	PFAM
Pfam:7tm_4	144	288	1.4e-44	PFAM
low complexity region	315	325	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	A	T	11: 23,516,563	D156E	probably benign	Het
2010300C02Rik	A	T	1: 37,624,945	I624N	possibly damaging	Het
Adam17	A	T	12: 21,353,948	V99E	probably damaging	Het
Akr1e1	T	C	13: 4,602,715	D41G	probably damaging	Het
Alcam	T	C	16: 52,305,655	I100V	probably benign	Het
Atr	T	C	9: 95,866,635	I411T	probably benign	Het
Bbs4	T	C	9: 59,323,481	S453G	probably benign	Het
Brdt	C	T	5: 107,359,215	L494F	probably benign	Het
Ccser1	T	C	6: 62,380,025	S816P	probably benign	Het
Cdk10	T	C	8: 123,230,608	I157T	probably damaging	Het
Ceacam5	G	A	7: 17,750,834		probably null	Het
Chst15	T	C	7: 132,269,030	I259V	possibly damaging	Het
Csmd1	A	T	8: 16,092,395	M1498K	probably damaging	Het
D630045J12Rik	T	C	6: 38,158,216	D1343G	probably damaging	Het
Denr	T	C	5: 123,908,187	Y27H	probably benign	Het
Dopey1	T	C	9: 86,531,772		probably null	Het
Epg5	T	C	18: 78,014,163	F1819S	probably damaging	Het
Flg2	T	A	3: 93,201,335	Y223*	probably null	Het
Fry	T	C	5: 150,428,230	L1733P	probably benign	Het
Gabrb2	T	C	11: 42,597,613	V302A	probably damaging	Het
Gimap9	G	A	6: 48,677,667	D53N	probably damaging	Het
Gje1	G	T	10: 14,718,142	L3I	possibly damaging	Het
Gm49383	G	T	12: 69,192,812	A645E	probably damaging	Het
Gm8947	G	A	1: 151,192,596	G60D	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gys2	A	G	6: 142,459,380		probably null	Het
Hace1	A	G	10: 45,618,502	H136R	probably damaging	Het
Herc3	T	G	6: 58,916,459	V902G	probably damaging	Het
Hspbp1	T	C	7: 4,684,607	R2G	probably benign	Het
Iqch	T	A	9: 63,480,574	K811N	possibly damaging	Het
Kmt2a	A	G	9: 44,842,665		probably benign	Het
Lonrf2	A	T	1: 38,804,336	V372D	probably benign	Het
Lpin2	T	C	17: 71,244,791	Y729H	probably damaging	Het
Lrrc32	A	G	7: 98,499,264	N417S	possibly damaging	Het
Malrd1	T	A	2: 15,797,667	C1064S	unknown	Het
Mast3	G	A	8: 70,799,471	R20*	probably null	Het
Mypn	A	C	10: 63,116,939	I174S	probably damaging	Het
Nrg1	G	A	8: 31,818,506	T505M	probably damaging	Het
Olfr1340	A	G	4: 118,727,141	K298R	probably damaging	Het
Olfr18	A	G	9: 20,314,099	Y266H	probably damaging	Het
Olfr8	A	G	10: 78,955,781	D192G	possibly damaging	Het
Phf3	T	C	1: 30,811,877	E1132G	probably damaging	Het
Pla2g4d	A	T	2: 120,270,633	M521K	probably damaging	Het
Plekhg1	A	G	10: 3,963,770	H1164R	possibly damaging	Het
Plxnb2	A	G	15: 89,160,389	V1218A	probably benign	Het
Pold1	A	G	7: 44,542,206	S119P	probably benign	Het
Pole	T	A	5: 110,293,290	D203E	probably benign	Het
Rapgefl1	T	A	11: 98,847,121	L387Q	probably damaging	Het
Rbm33	T	C	5: 28,352,506	I199T	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rufy1	C	A	11: 50,398,380	R545L	probably benign	Het
Ryr3	T	A	2: 112,860,354	D1117V	probably damaging	Het
Sap130	T	C	18: 31,682,088	V621A	possibly damaging	Het
Sparcl1	T	A	5: 104,087,074	Y525F	probably damaging	Het
Spon2	A	G	5: 33,216,427	V180A	probably benign	Het
Trav10n	G	A	14: 53,122,490	V75M	probably benign	Het
Ttc34	T	C	4: 154,839,086	L84P	probably damaging	Het
Vmn1r23	C	T	6: 57,926,145	R216K	probably benign	Het
Vmn2r61	A	G	7: 42,299,940	T595A	probably benign	Het
Vmn2r66	T	A	7: 85,012,008	I5F	possibly damaging	Het
Zfp879	C	T	11: 50,833,012	G406R	probably damaging	Het
Zic2	A	T	14: 122,476,457	D261V	probably damaging	Het

Other mutations in Olfr220

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Olfr220	APN	1	174448667	missense	probably benign	0.00
IGL03369:Olfr220	APN	1	174448869	missense	probably damaging	1.00
R1792:Olfr220	UTSW	1	174448737	missense	probably benign
R4090:Olfr220	UTSW	1	174448934	missense	probably benign	0.01
R4169:Olfr220	UTSW	1	174449596	missense	unknown
R4769:Olfr220	UTSW	1	174448958	missense	possibly damaging	0.80
R6652:Olfr220	UTSW	1	174449061	missense	probably damaging	1.00
R7237:Olfr220	UTSW	1	174449339	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TGGCTGCATGACACAACTTTAC -3'
(R):5'- ACGGGATCTTGAGAATGGTG -3'

Sequencing Primer
(F):5'- GCATGACACAACTTTACTTCTTTG -3'
(R):5'- TGGCATAAGATGTCACAACCAC -3'

Posted On

2018-11-06