Incidental Mutation 'R6930:Flg2'
ID 539927
Institutional Source Beutler Lab
Gene Symbol Flg2
Ensembl Gene ENSMUSG00000049133
Gene Name filaggrin family member 2
Synonyms EG229574
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R6930 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 93197278-93221391 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 93201335 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 223 (Y223*)
Ref Sequence ENSEMBL: ENSMUSP00000096482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098884]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000098884
AA Change: Y223*
SMART Domains Protein: ENSMUSP00000096482
Gene: ENSMUSG00000049133
AA Change: Y223*

DomainStartEndE-ValueType
Pfam:S_100 4 46 1.2e-17 PFAM
low complexity region 58 70 N/A INTRINSIC
low complexity region 110 121 N/A INTRINSIC
low complexity region 131 146 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
internal_repeat_2 230 347 7.36e-7 PROSPERO
internal_repeat_2 349 466 7.36e-7 PROSPERO
internal_repeat_3 366 392 6.93e-6 PROSPERO
internal_repeat_6 419 471 4.17e-5 PROSPERO
low complexity region 474 550 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 593 679 N/A INTRINSIC
low complexity region 680 705 N/A INTRINSIC
low complexity region 719 748 N/A INTRINSIC
low complexity region 749 768 N/A INTRINSIC
low complexity region 772 800 N/A INTRINSIC
internal_repeat_5 804 825 4.17e-5 PROSPERO
internal_repeat_3 810 836 6.93e-6 PROSPERO
low complexity region 846 860 N/A INTRINSIC
low complexity region 863 885 N/A INTRINSIC
internal_repeat_5 895 919 4.17e-5 PROSPERO
internal_repeat_4 899 939 1.7e-5 PROSPERO
internal_repeat_1 944 1461 8.08e-127 PROSPERO
internal_repeat_6 1335 1386 4.17e-5 PROSPERO
low complexity region 1465 1485 N/A INTRINSIC
internal_repeat_1 1486 2009 8.08e-127 PROSPERO
internal_repeat_4 2123 2173 1.7e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,516,563 D156E probably benign Het
2010300C02Rik A T 1: 37,624,945 I624N possibly damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Akr1e1 T C 13: 4,602,715 D41G probably damaging Het
Alcam T C 16: 52,305,655 I100V probably benign Het
Atr T C 9: 95,866,635 I411T probably benign Het
Bbs4 T C 9: 59,323,481 S453G probably benign Het
Brdt C T 5: 107,359,215 L494F probably benign Het
Ccser1 T C 6: 62,380,025 S816P probably benign Het
Cdk10 T C 8: 123,230,608 I157T probably damaging Het
Ceacam5 G A 7: 17,750,834 probably null Het
Chst15 T C 7: 132,269,030 I259V possibly damaging Het
Csmd1 A T 8: 16,092,395 M1498K probably damaging Het
D630045J12Rik T C 6: 38,158,216 D1343G probably damaging Het
Denr T C 5: 123,908,187 Y27H probably benign Het
Dopey1 T C 9: 86,531,772 probably null Het
Epg5 T C 18: 78,014,163 F1819S probably damaging Het
Fry T C 5: 150,428,230 L1733P probably benign Het
Gabrb2 T C 11: 42,597,613 V302A probably damaging Het
Gimap9 G A 6: 48,677,667 D53N probably damaging Het
Gje1 G T 10: 14,718,142 L3I possibly damaging Het
Gm49383 G T 12: 69,192,812 A645E probably damaging Het
Gm8947 G A 1: 151,192,596 G60D probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gys2 A G 6: 142,459,380 probably null Het
Hace1 A G 10: 45,618,502 H136R probably damaging Het
Herc3 T G 6: 58,916,459 V902G probably damaging Het
Hspbp1 T C 7: 4,684,607 R2G probably benign Het
Iqch T A 9: 63,480,574 K811N possibly damaging Het
Kmt2a A G 9: 44,842,665 probably benign Het
Lonrf2 A T 1: 38,804,336 V372D probably benign Het
Lpin2 T C 17: 71,244,791 Y729H probably damaging Het
Lrrc32 A G 7: 98,499,264 N417S possibly damaging Het
Malrd1 T A 2: 15,797,667 C1064S unknown Het
Mast3 G A 8: 70,799,471 R20* probably null Het
Mypn A C 10: 63,116,939 I174S probably damaging Het
Nrg1 G A 8: 31,818,506 T505M probably damaging Het
Olfr1340 A G 4: 118,727,141 K298R probably damaging Het
Olfr18 A G 9: 20,314,099 Y266H probably damaging Het
Olfr220 A G 1: 174,449,111 I163V probably damaging Het
Olfr8 A G 10: 78,955,781 D192G possibly damaging Het
Phf3 T C 1: 30,811,877 E1132G probably damaging Het
Pla2g4d A T 2: 120,270,633 M521K probably damaging Het
Plekhg1 A G 10: 3,963,770 H1164R possibly damaging Het
Plxnb2 A G 15: 89,160,389 V1218A probably benign Het
Pold1 A G 7: 44,542,206 S119P probably benign Het
Pole T A 5: 110,293,290 D203E probably benign Het
Rapgefl1 T A 11: 98,847,121 L387Q probably damaging Het
Rbm33 T C 5: 28,352,506 I199T probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 C A 11: 50,398,380 R545L probably benign Het
Ryr3 T A 2: 112,860,354 D1117V probably damaging Het
Sap130 T C 18: 31,682,088 V621A possibly damaging Het
Sparcl1 T A 5: 104,087,074 Y525F probably damaging Het
Spon2 A G 5: 33,216,427 V180A probably benign Het
Trav10n G A 14: 53,122,490 V75M probably benign Het
Ttc34 T C 4: 154,839,086 L84P probably damaging Het
Vmn1r23 C T 6: 57,926,145 R216K probably benign Het
Vmn2r61 A G 7: 42,299,940 T595A probably benign Het
Vmn2r66 T A 7: 85,012,008 I5F possibly damaging Het
Zfp879 C T 11: 50,833,012 G406R probably damaging Het
Zic2 A T 14: 122,476,457 D261V probably damaging Het
Other mutations in Flg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Flg2 APN 3 93202109 nonsense probably null
IGL00092:Flg2 APN 3 93219855 missense possibly damaging 0.90
IGL00985:Flg2 APN 3 93203278 missense unknown
IGL01077:Flg2 APN 3 93220206 missense unknown
IGL01093:Flg2 APN 3 93202371 missense unknown
IGL01120:Flg2 APN 3 93201168 missense probably damaging 0.99
IGL01473:Flg2 APN 3 93203020 missense unknown
IGL01584:Flg2 APN 3 93213466 missense unknown
IGL01584:Flg2 APN 3 93215470 missense unknown
IGL01686:Flg2 APN 3 93202284 missense unknown
IGL02207:Flg2 APN 3 93220128 missense unknown
IGL02294:Flg2 APN 3 93203746 missense unknown
IGL02418:Flg2 APN 3 93201054 missense probably benign 0.26
IGL02581:Flg2 APN 3 93219892 missense unknown
IGL02719:Flg2 APN 3 93220131 nonsense probably null
IGL02795:Flg2 APN 3 93203613 missense unknown
IGL02893:Flg2 APN 3 93203613 missense unknown
IGL02958:Flg2 APN 3 93203613 missense unknown
IGL03060:Flg2 APN 3 93203613 missense unknown
IGL03088:Flg2 APN 3 93203191 missense unknown
IGL03165:Flg2 APN 3 93214611 missense unknown
IGL03342:Flg2 APN 3 93201235 missense probably damaging 1.00
IGL03352:Flg2 APN 3 93202494 missense unknown
IGL02796:Flg2 UTSW 3 93203613 missense unknown
IGL02837:Flg2 UTSW 3 93201737 missense probably damaging 1.00
PIT4618001:Flg2 UTSW 3 93203781 missense unknown
R0087:Flg2 UTSW 3 93202431 missense unknown
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0233:Flg2 UTSW 3 93201797 nonsense probably null
R0315:Flg2 UTSW 3 93214722 missense unknown
R0390:Flg2 UTSW 3 93200355 splice site probably benign
R0462:Flg2 UTSW 3 93201437 missense probably benign 0.18
R0553:Flg2 UTSW 3 93203584 missense unknown
R0828:Flg2 UTSW 3 93203332 missense unknown
R1006:Flg2 UTSW 3 93201207 missense probably benign 0.41
R1444:Flg2 UTSW 3 93202313 missense unknown
R1497:Flg2 UTSW 3 93219769 missense unknown
R1518:Flg2 UTSW 3 93203138 missense unknown
R1737:Flg2 UTSW 3 93203621 missense unknown
R1780:Flg2 UTSW 3 93202999 missense unknown
R1797:Flg2 UTSW 3 93200976 missense probably damaging 1.00
R2065:Flg2 UTSW 3 93202231 missense unknown
R2168:Flg2 UTSW 3 93201937 missense probably damaging 1.00
R2220:Flg2 UTSW 3 93202185 missense unknown
R2292:Flg2 UTSW 3 93220677 missense unknown
R2327:Flg2 UTSW 3 93203606 nonsense probably null
R2512:Flg2 UTSW 3 93201775 missense probably damaging 1.00
R3177:Flg2 UTSW 3 93214888 missense unknown
R3277:Flg2 UTSW 3 93214888 missense unknown
R3522:Flg2 UTSW 3 93220027 missense unknown
R3779:Flg2 UTSW 3 93202423 missense unknown
R3926:Flg2 UTSW 3 93203215 missense unknown
R4082:Flg2 UTSW 3 93203521 missense unknown
R4407:Flg2 UTSW 3 93214869 missense unknown
R5152:Flg2 UTSW 3 93214977 missense unknown
R5253:Flg2 UTSW 3 93200812 missense probably damaging 1.00
R5290:Flg2 UTSW 3 93220566 missense unknown
R5464:Flg2 UTSW 3 93201970 missense possibly damaging 0.73
R5539:Flg2 UTSW 3 93220446 missense unknown
R5622:Flg2 UTSW 3 93202564 missense unknown
R5788:Flg2 UTSW 3 93200989 missense probably benign 0.41
R5792:Flg2 UTSW 3 93203497 missense unknown
R5831:Flg2 UTSW 3 93200234 missense probably damaging 1.00
R5877:Flg2 UTSW 3 93203449 missense unknown
R6041:Flg2 UTSW 3 93220361 missense probably benign 0.01
R6189:Flg2 UTSW 3 93220074 missense unknown
R6214:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6215:Flg2 UTSW 3 93201859 missense possibly damaging 0.83
R6239:Flg2 UTSW 3 93201272 missense probably benign 0.36
R6288:Flg2 UTSW 3 93203785 missense unknown
R6413:Flg2 UTSW 3 93220376 missense unknown
R6457:Flg2 UTSW 3 93220482 missense unknown
R6468:Flg2 UTSW 3 93214421 missense unknown
R6667:Flg2 UTSW 3 93201761 missense possibly damaging 0.88
R6996:Flg2 UTSW 3 93202670 missense unknown
R6996:Flg2 UTSW 3 93202949 missense unknown
R7100:Flg2 UTSW 3 93203711 missense unknown
R7133:Flg2 UTSW 3 93219762 missense unknown
R7180:Flg2 UTSW 3 93202833 missense unknown
R7325:Flg2 UTSW 3 93203372 missense unknown
R7349:Flg2 UTSW 3 93220206 missense unknown
R7531:Flg2 UTSW 3 93200870 missense probably damaging 0.99
R7571:Flg2 UTSW 3 93219996 nonsense probably null
R7684:Flg2 UTSW 3 93219649 missense unknown
R7810:Flg2 UTSW 3 93200241 missense possibly damaging 0.70
R7853:Flg2 UTSW 3 93220747 missense unknown
R8031:Flg2 UTSW 3 93220214 missense unknown
R8078:Flg2 UTSW 3 93200275 missense probably damaging 1.00
R8142:Flg2 UTSW 3 93215475 nonsense probably null
R8156:Flg2 UTSW 3 93220083 missense unknown
R8172:Flg2 UTSW 3 93201161 missense possibly damaging 0.94
R8204:Flg2 UTSW 3 93202767 missense unknown
R8262:Flg2 UTSW 3 93220210 missense unknown
R8269:Flg2 UTSW 3 93201880 missense possibly damaging 0.68
R8290:Flg2 UTSW 3 93202762 missense unknown
R8444:Flg2 UTSW 3 93200278 missense probably damaging 0.97
R8670:Flg2 UTSW 3 93201484 missense probably damaging 0.97
R8755:Flg2 UTSW 3 93200813 missense probably damaging 1.00
R9039:Flg2 UTSW 3 93203592 missense unknown
R9116:Flg2 UTSW 3 93202284 missense unknown
R9214:Flg2 UTSW 3 93203577 missense unknown
R9231:Flg2 UTSW 3 93202201 missense unknown
R9553:Flg2 UTSW 3 93214594 missense unknown
R9607:Flg2 UTSW 3 93201412 missense probably damaging 0.98
R9735:Flg2 UTSW 3 93220362 missense unknown
R9752:Flg2 UTSW 3 93201160 missense probably damaging 0.98
Z1177:Flg2 UTSW 3 93202420 missense unknown
Z1177:Flg2 UTSW 3 93202738 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGTCCAACTCTAAGAGGTTGG -3'
(R):5'- GGTCTGCAACATCCACTAGAATTG -3'

Sequencing Primer
(F):5'- GGCAAGATGAATTATCCAGCTC -3'
(R):5'- GCAACATCCACTAGAATTGCTAAAAC -3'
Posted On 2018-11-06