Mutagenetix > Incidental Mutations

Incidental Mutation 'R6930:Brdt'

539933

Institutional Source

Beutler Lab

Gene Symbol

Brdt

Ensembl Gene

ENSMUSG00000029279

Gene Name

bromodomain, testis-specific

Synonyms

Fsrg3, 7420412D09Rik, Brd6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6930 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107331159-107387058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 107359215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 494 (L494F)

Ref Sequence

ENSEMBL: ENSMUSP00000031215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031215]

AlphaFold

Q91Y44

PDB Structure

Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000031215
AA Change: L494F

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: L494F

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
BROMO	268	377	2.18e-40	SMART
low complexity region	392	417	N/A	INTRINSIC
low complexity region	446	455	N/A	INTRINSIC
low complexity region	472	500	N/A	INTRINSIC
Pfam:BET	505	569	9.2e-34	PFAM
low complexity region	585	603	N/A	INTRINSIC
low complexity region	649	691	N/A	INTRINSIC
low complexity region	895	909	N/A	INTRINSIC
Pfam:BRD4_CDT	913	956	3e-26	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	A	T	11: 23,516,563	D156E	probably benign	Het
2010300C02Rik	A	T	1: 37,624,945	I624N	possibly damaging	Het
Adam17	A	T	12: 21,353,948	V99E	probably damaging	Het
Akr1e1	T	C	13: 4,602,715	D41G	probably damaging	Het
Alcam	T	C	16: 52,305,655	I100V	probably benign	Het
Atr	T	C	9: 95,866,635	I411T	probably benign	Het
Bbs4	T	C	9: 59,323,481	S453G	probably benign	Het
Ccser1	T	C	6: 62,380,025	S816P	probably benign	Het
Cdk10	T	C	8: 123,230,608	I157T	probably damaging	Het
Ceacam5	G	A	7: 17,750,834		probably null	Het
Chst15	T	C	7: 132,269,030	I259V	possibly damaging	Het
Csmd1	A	T	8: 16,092,395	M1498K	probably damaging	Het
D630045J12Rik	T	C	6: 38,158,216	D1343G	probably damaging	Het
Denr	T	C	5: 123,908,187	Y27H	probably benign	Het
Dopey1	T	C	9: 86,531,772		probably null	Het
Epg5	T	C	18: 78,014,163	F1819S	probably damaging	Het
Flg2	T	A	3: 93,201,335	Y223*	probably null	Het
Fry	T	C	5: 150,428,230	L1733P	probably benign	Het
Gabrb2	T	C	11: 42,597,613	V302A	probably damaging	Het
Gimap9	G	A	6: 48,677,667	D53N	probably damaging	Het
Gje1	G	T	10: 14,718,142	L3I	possibly damaging	Het
Gm49383	G	T	12: 69,192,812	A645E	probably damaging	Het
Gm8947	G	A	1: 151,192,596	G60D	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gys2	A	G	6: 142,459,380		probably null	Het
Hace1	A	G	10: 45,618,502	H136R	probably damaging	Het
Herc3	T	G	6: 58,916,459	V902G	probably damaging	Het
Hspbp1	T	C	7: 4,684,607	R2G	probably benign	Het
Iqch	T	A	9: 63,480,574	K811N	possibly damaging	Het
Kmt2a	A	G	9: 44,842,665		probably benign	Het
Lonrf2	A	T	1: 38,804,336	V372D	probably benign	Het
Lpin2	T	C	17: 71,244,791	Y729H	probably damaging	Het
Lrrc32	A	G	7: 98,499,264	N417S	possibly damaging	Het
Malrd1	T	A	2: 15,797,667	C1064S	unknown	Het
Mast3	G	A	8: 70,799,471	R20*	probably null	Het
Mypn	A	C	10: 63,116,939	I174S	probably damaging	Het
Nrg1	G	A	8: 31,818,506	T505M	probably damaging	Het
Olfr1340	A	G	4: 118,727,141	K298R	probably damaging	Het
Olfr18	A	G	9: 20,314,099	Y266H	probably damaging	Het
Olfr220	A	G	1: 174,449,111	I163V	probably damaging	Het
Olfr8	A	G	10: 78,955,781	D192G	possibly damaging	Het
Phf3	T	C	1: 30,811,877	E1132G	probably damaging	Het
Pla2g4d	A	T	2: 120,270,633	M521K	probably damaging	Het
Plekhg1	A	G	10: 3,963,770	H1164R	possibly damaging	Het
Plxnb2	A	G	15: 89,160,389	V1218A	probably benign	Het
Pold1	A	G	7: 44,542,206	S119P	probably benign	Het
Pole	T	A	5: 110,293,290	D203E	probably benign	Het
Rapgefl1	T	A	11: 98,847,121	L387Q	probably damaging	Het
Rbm33	T	C	5: 28,352,506	I199T	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rufy1	C	A	11: 50,398,380	R545L	probably benign	Het
Ryr3	T	A	2: 112,860,354	D1117V	probably damaging	Het
Sap130	T	C	18: 31,682,088	V621A	possibly damaging	Het
Sparcl1	T	A	5: 104,087,074	Y525F	probably damaging	Het
Spon2	A	G	5: 33,216,427	V180A	probably benign	Het
Trav10n	G	A	14: 53,122,490	V75M	probably benign	Het
Ttc34	T	C	4: 154,839,086	L84P	probably damaging	Het
Vmn1r23	C	T	6: 57,926,145	R216K	probably benign	Het
Vmn2r61	A	G	7: 42,299,940	T595A	probably benign	Het
Vmn2r66	T	A	7: 85,012,008	I5F	possibly damaging	Het
Zfp879	C	T	11: 50,833,012	G406R	probably damaging	Het
Zic2	A	T	14: 122,476,457	D261V	probably damaging	Het

Other mutations in Brdt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02342:Brdt	APN	5	107342203	missense	probably damaging	1.00
IGL02718:Brdt	APN	5	107350068	splice site	probably benign
IGL02746:Brdt	APN	5	107370324	missense	probably benign
IGL02851:Brdt	APN	5	107377995	missense	possibly damaging	0.47
R0585:Brdt	UTSW	5	107356882	critical splice donor site	probably null
R0708:Brdt	UTSW	5	107358900	nonsense	probably null
R1338:Brdt	UTSW	5	107350188	missense	probably benign	0.02
R1710:Brdt	UTSW	5	107343584	missense	probably damaging	1.00
R1794:Brdt	UTSW	5	107359853	small deletion	probably benign
R1861:Brdt	UTSW	5	107359458	missense	probably benign
R1913:Brdt	UTSW	5	107348613	missense	probably benign
R2029:Brdt	UTSW	5	107359224	missense	probably benign	0.35
R2431:Brdt	UTSW	5	107378015	splice site	probably null
R3121:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R3122:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R4258:Brdt	UTSW	5	107359909	missense	probably damaging	0.97
R4609:Brdt	UTSW	5	107359936	missense	probably benign	0.00
R5306:Brdt	UTSW	5	107345144	missense	probably damaging	1.00
R5640:Brdt	UTSW	5	107359308	nonsense	probably null
R5677:Brdt	UTSW	5	107348617	missense	possibly damaging	0.85
R5936:Brdt	UTSW	5	107359395	missense	probably damaging	1.00
R6145:Brdt	UTSW	5	107377999	missense	possibly damaging	0.67
R6261:Brdt	UTSW	5	107348503	missense	probably benign	0.04
R6408:Brdt	UTSW	5	107385492	missense	probably damaging	1.00
R7372:Brdt	UTSW	5	107370294	missense	possibly damaging	0.49
R7741:Brdt	UTSW	5	107358886	missense	probably benign	0.00
R7842:Brdt	UTSW	5	107348588	missense	possibly damaging	0.49
R7869:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R7887:Brdt	UTSW	5	107359933	missense	possibly damaging	0.66
R7972:Brdt	UTSW	5	107348549	missense	possibly damaging	0.53
R8064:Brdt	UTSW	5	107377996	nonsense	probably null
R8958:Brdt	UTSW	5	107378011	missense	probably benign
R9199:Brdt	UTSW	5	107350163	nonsense	probably null
R9346:Brdt	UTSW	5	107377014	missense	probably damaging	0.99
X0011:Brdt	UTSW	5	107342128	missense	probably damaging	0.96
X0011:Brdt	UTSW	5	107377092	missense	probably damaging	1.00
Z1176:Brdt	UTSW	5	107359898	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TCAAGTAAGCATGTTCAGTGAGTG -3'
(R):5'- GCCTTCAGGGTCTCAAAGTC -3'

Sequencing Primer
(F):5'- AGTGAGTGACTGCCCAGG -3'
(R):5'- TCAGGGTCTCAAAGTCGATCTCG -3'

Posted On

2018-11-06