Incidental Mutation 'R6930:D630045J12Rik'
ID539937
Institutional Source Beutler Lab
Gene Symbol D630045J12Rik
Ensembl Gene ENSMUSG00000063455
Gene NameRIKEN cDNA D630045J12 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6930 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location38123174-38254009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38158216 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1343 (D1343G)
Ref Sequence ENSEMBL: ENSMUSP00000130121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117556] [ENSMUST00000169256]
Predicted Effect probably damaging
Transcript: ENSMUST00000117556
AA Change: D1202G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112939
Gene: ENSMUSG00000063455
AA Change: D1202G

DomainStartEndE-ValueType
low complexity region 190 203 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
low complexity region 414 431 N/A INTRINSIC
low complexity region 528 573 N/A INTRINSIC
low complexity region 581 598 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
Pfam:DUF3827 746 1412 N/A PFAM
low complexity region 1480 1500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169256
AA Change: D1343G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130121
Gene: ENSMUSG00000063455
AA Change: D1343G

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
low complexity region 693 710 N/A INTRINSIC
low complexity region 807 852 N/A INTRINSIC
low complexity region 860 877 N/A INTRINSIC
transmembrane domain 987 1009 N/A INTRINSIC
Pfam:DUF3827 1026 1691 7.1e-301 PFAM
low complexity region 1759 1779 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the UPF0606 family. This gene has been found to be fused to the BRAF oncogene in many cases of pilocytic astrocytoma. The fusion results from 2Mb tandem duplications at 7q34. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,516,563 D156E probably benign Het
2010300C02Rik A T 1: 37,624,945 I624N possibly damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Akr1e1 T C 13: 4,602,715 D41G probably damaging Het
Alcam T C 16: 52,305,655 I100V probably benign Het
Atr T C 9: 95,866,635 I411T probably benign Het
Bbs4 T C 9: 59,323,481 S453G probably benign Het
Brdt C T 5: 107,359,215 L494F probably benign Het
Ccser1 T C 6: 62,380,025 S816P probably benign Het
Cdk10 T C 8: 123,230,608 I157T probably damaging Het
Ceacam5 G A 7: 17,750,834 probably null Het
Chst15 T C 7: 132,269,030 I259V possibly damaging Het
Csmd1 A T 8: 16,092,395 M1498K probably damaging Het
Denr T C 5: 123,908,187 Y27H probably benign Het
Dopey1 T C 9: 86,531,772 probably null Het
Epg5 T C 18: 78,014,163 F1819S probably damaging Het
Flg2 T A 3: 93,201,335 Y223* probably null Het
Fry T C 5: 150,428,230 L1733P probably benign Het
Gabrb2 T C 11: 42,597,613 V302A probably damaging Het
Gimap9 G A 6: 48,677,667 D53N probably damaging Het
Gje1 G T 10: 14,718,142 L3I possibly damaging Het
Gm49383 G T 12: 69,192,812 A645E probably damaging Het
Gm8947 G A 1: 151,192,596 G60D probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gys2 A G 6: 142,459,380 probably null Het
Hace1 A G 10: 45,618,502 H136R probably damaging Het
Herc3 T G 6: 58,916,459 V902G probably damaging Het
Hspbp1 T C 7: 4,684,607 R2G probably benign Het
Iqch T A 9: 63,480,574 K811N possibly damaging Het
Kmt2a A G 9: 44,842,665 probably benign Het
Lonrf2 A T 1: 38,804,336 V372D probably benign Het
Lpin2 T C 17: 71,244,791 Y729H probably damaging Het
Lrrc32 A G 7: 98,499,264 N417S possibly damaging Het
Malrd1 T A 2: 15,797,667 C1064S unknown Het
Mast3 G A 8: 70,799,471 R20* probably null Het
Mypn A C 10: 63,116,939 I174S probably damaging Het
Nrg1 G A 8: 31,818,506 T505M probably damaging Het
Olfr1340 A G 4: 118,727,141 K298R probably damaging Het
Olfr18 A G 9: 20,314,099 Y266H probably damaging Het
Olfr220 A G 1: 174,449,111 I163V probably damaging Het
Olfr8 A G 10: 78,955,781 D192G possibly damaging Het
Phf3 T C 1: 30,811,877 E1132G probably damaging Het
Pla2g4d A T 2: 120,270,633 M521K probably damaging Het
Plekhg1 A G 10: 3,963,770 H1164R possibly damaging Het
Plxnb2 A G 15: 89,160,389 V1218A probably benign Het
Pold1 A G 7: 44,542,206 S119P probably benign Het
Pole T A 5: 110,293,290 D203E probably benign Het
Rapgefl1 T A 11: 98,847,121 L387Q probably damaging Het
Rbm33 T C 5: 28,352,506 I199T probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 C A 11: 50,398,380 R545L probably benign Het
Ryr3 T A 2: 112,860,354 D1117V probably damaging Het
Sap130 T C 18: 31,682,088 V621A possibly damaging Het
Sparcl1 T A 5: 104,087,074 Y525F probably damaging Het
Spon2 A G 5: 33,216,427 V180A probably benign Het
Trav10n G A 14: 53,122,490 V75M probably benign Het
Ttc34 T C 4: 154,839,086 L84P probably damaging Het
Vmn1r23 C T 6: 57,926,145 R216K probably benign Het
Vmn2r61 A G 7: 42,299,940 T595A probably benign Het
Vmn2r66 T A 7: 85,012,008 I5F possibly damaging Het
Zfp879 C T 11: 50,833,012 G406R probably damaging Het
Zic2 A T 14: 122,476,457 D261V probably damaging Het
Other mutations in D630045J12Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:D630045J12Rik APN 6 38194930 missense probably benign 0.03
IGL01089:D630045J12Rik APN 6 38136963 missense probably benign
IGL01745:D630045J12Rik APN 6 38191720 missense probably damaging 0.99
IGL02069:D630045J12Rik APN 6 38184072 missense probably damaging 0.98
IGL02238:D630045J12Rik APN 6 38196394 missense probably benign
IGL02496:D630045J12Rik APN 6 38149705 missense probably damaging 1.00
IGL02675:D630045J12Rik APN 6 38195485 missense possibly damaging 0.93
IGL03030:D630045J12Rik APN 6 38149713 missense probably damaging 1.00
IGL03203:D630045J12Rik APN 6 38168221 missense probably damaging 0.98
IGL03205:D630045J12Rik APN 6 38147259 missense probably damaging 1.00
PIT4472001:D630045J12Rik UTSW 6 38178839 missense probably damaging 1.00
PIT4687001:D630045J12Rik UTSW 6 38195101 missense probably benign
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0021:D630045J12Rik UTSW 6 38183967 nonsense probably null
R0128:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0130:D630045J12Rik UTSW 6 38149771 splice site probably benign
R0206:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0208:D630045J12Rik UTSW 6 38139450 missense probably damaging 0.99
R0347:D630045J12Rik UTSW 6 38181392 missense probably damaging 0.97
R0396:D630045J12Rik UTSW 6 38196736 missense possibly damaging 0.85
R0538:D630045J12Rik UTSW 6 38191693 missense probably damaging 1.00
R0636:D630045J12Rik UTSW 6 38196778 missense probably benign
R0842:D630045J12Rik UTSW 6 38148465 missense probably damaging 1.00
R1120:D630045J12Rik UTSW 6 38194770 missense probably damaging 0.96
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1323:D630045J12Rik UTSW 6 38148508 missense probably damaging 1.00
R1412:D630045J12Rik UTSW 6 38195760 missense probably benign 0.03
R1546:D630045J12Rik UTSW 6 38190655 missense probably damaging 1.00
R1649:D630045J12Rik UTSW 6 38181431 missense probably damaging 0.98
R1704:D630045J12Rik UTSW 6 38139427 missense probably benign 0.14
R1969:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R1971:D630045J12Rik UTSW 6 38168143 missense probably damaging 1.00
R2182:D630045J12Rik UTSW 6 38174147 critical splice donor site probably null
R2354:D630045J12Rik UTSW 6 38158091 missense possibly damaging 0.88
R2926:D630045J12Rik UTSW 6 38168171 missense probably damaging 1.00
R3768:D630045J12Rik UTSW 6 38142909 missense probably damaging 1.00
R3886:D630045J12Rik UTSW 6 38142698 missense possibly damaging 0.90
R4439:D630045J12Rik UTSW 6 38194761 missense probably benign 0.07
R4688:D630045J12Rik UTSW 6 38196657 missense possibly damaging 0.85
R4739:D630045J12Rik UTSW 6 38196036 missense possibly damaging 0.76
R4748:D630045J12Rik UTSW 6 38196841 missense possibly damaging 0.91
R4792:D630045J12Rik UTSW 6 38148340 missense probably damaging 1.00
R4794:D630045J12Rik UTSW 6 38194485 missense possibly damaging 0.90
R4947:D630045J12Rik UTSW 6 38148543 missense probably damaging 1.00
R4959:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R4973:D630045J12Rik UTSW 6 38148367 missense possibly damaging 0.81
R5261:D630045J12Rik UTSW 6 38194620 missense probably benign
R5344:D630045J12Rik UTSW 6 38158228 missense probably damaging 1.00
R5488:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5489:D630045J12Rik UTSW 6 38196847 missense possibly damaging 0.85
R5605:D630045J12Rik UTSW 6 38191764 missense probably damaging 1.00
R5828:D630045J12Rik UTSW 6 38196367 missense possibly damaging 0.47
R5831:D630045J12Rik UTSW 6 38142657 missense possibly damaging 0.80
R5939:D630045J12Rik UTSW 6 38194969 missense possibly damaging 0.70
R6021:D630045J12Rik UTSW 6 38190617 missense probably benign 0.05
R6060:D630045J12Rik UTSW 6 38130864 missense probably damaging 1.00
R6081:D630045J12Rik UTSW 6 38142698 missense probably damaging 0.99
R6498:D630045J12Rik UTSW 6 38147197 nonsense probably null
R7019:D630045J12Rik UTSW 6 38194635 missense probably benign 0.12
R7156:D630045J12Rik UTSW 6 38195029 missense possibly damaging 0.91
R7248:D630045J12Rik UTSW 6 38168263 missense probably damaging 1.00
R7249:D630045J12Rik UTSW 6 38136950 missense possibly damaging 0.95
R7250:D630045J12Rik UTSW 6 38142611 missense possibly damaging 0.80
R7376:D630045J12Rik UTSW 6 38174303 missense probably damaging 0.99
R7491:D630045J12Rik UTSW 6 38142666 missense possibly damaging 0.89
R7552:D630045J12Rik UTSW 6 38148448 missense probably damaging 0.99
R7560:D630045J12Rik UTSW 6 38196627 missense possibly damaging 0.72
R7593:D630045J12Rik UTSW 6 38195494 missense possibly damaging 0.93
R7624:D630045J12Rik UTSW 6 38149563 missense probably damaging 1.00
R7654:D630045J12Rik UTSW 6 38177701 missense probably damaging 1.00
R7950:D630045J12Rik UTSW 6 38181310 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACAGTCTAGAAAGCGCAGTAC -3'
(R):5'- AACCACCCATTGTGTTTCACG -3'

Sequencing Primer
(F):5'- GCAGTACTAACCTCCCTCTGAG -3'
(R):5'- AACCACCCCGTGTGTATTAC -3'
Posted On2018-11-06