Incidental Mutation 'R6930:Gimap9'
ID539938
Institutional Source Beutler Lab
Gene Symbol Gimap9
Ensembl Gene ENSMUSG00000051124
Gene NameGTPase, IMAP family member 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6930 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48676129-48679114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48677667 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 53 (D53N)
Ref Sequence ENSEMBL: ENSMUSP00000122830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054050] [ENSMUST00000147936]
Predicted Effect probably damaging
Transcript: ENSMUST00000054050
AA Change: D63N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050330
Gene: ENSMUSG00000051124
AA Change: D63N

DomainStartEndE-ValueType
Pfam:AIG1 9 219 8.5e-83 PFAM
Pfam:MMR_HSR1 10 157 3.4e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000147936
AA Change: D53N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122830
Gene: ENSMUSG00000051124
AA Change: D53N

DomainStartEndE-ValueType
Pfam:MMR_HSR1 1 123 7.3e-11 PFAM
Pfam:AIG1 1 138 5.6e-61 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the GTP-binding superfamily and to the immuno-associated nucleotide (IAN) subfamily of nucleotide-binding proteins. In humans, the IAN subfamily genes are located in a cluster at 7q36.1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,516,563 D156E probably benign Het
2010300C02Rik A T 1: 37,624,945 I624N possibly damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Akr1e1 T C 13: 4,602,715 D41G probably damaging Het
Alcam T C 16: 52,305,655 I100V probably benign Het
Atr T C 9: 95,866,635 I411T probably benign Het
Bbs4 T C 9: 59,323,481 S453G probably benign Het
Brdt C T 5: 107,359,215 L494F probably benign Het
Ccser1 T C 6: 62,380,025 S816P probably benign Het
Cdk10 T C 8: 123,230,608 I157T probably damaging Het
Ceacam5 G A 7: 17,750,834 probably null Het
Chst15 T C 7: 132,269,030 I259V possibly damaging Het
Csmd1 A T 8: 16,092,395 M1498K probably damaging Het
D630045J12Rik T C 6: 38,158,216 D1343G probably damaging Het
Denr T C 5: 123,908,187 Y27H probably benign Het
Dopey1 T C 9: 86,531,772 probably null Het
Epg5 T C 18: 78,014,163 F1819S probably damaging Het
Flg2 T A 3: 93,201,335 Y223* probably null Het
Fry T C 5: 150,428,230 L1733P probably benign Het
Gabrb2 T C 11: 42,597,613 V302A probably damaging Het
Gje1 G T 10: 14,718,142 L3I possibly damaging Het
Gm49383 G T 12: 69,192,812 A645E probably damaging Het
Gm8947 G A 1: 151,192,596 G60D probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gys2 A G 6: 142,459,380 probably null Het
Hace1 A G 10: 45,618,502 H136R probably damaging Het
Herc3 T G 6: 58,916,459 V902G probably damaging Het
Hspbp1 T C 7: 4,684,607 R2G probably benign Het
Iqch T A 9: 63,480,574 K811N possibly damaging Het
Kmt2a A G 9: 44,842,665 probably benign Het
Lonrf2 A T 1: 38,804,336 V372D probably benign Het
Lpin2 T C 17: 71,244,791 Y729H probably damaging Het
Lrrc32 A G 7: 98,499,264 N417S possibly damaging Het
Malrd1 T A 2: 15,797,667 C1064S unknown Het
Mast3 G A 8: 70,799,471 R20* probably null Het
Mypn A C 10: 63,116,939 I174S probably damaging Het
Nrg1 G A 8: 31,818,506 T505M probably damaging Het
Olfr1340 A G 4: 118,727,141 K298R probably damaging Het
Olfr18 A G 9: 20,314,099 Y266H probably damaging Het
Olfr220 A G 1: 174,449,111 I163V probably damaging Het
Olfr8 A G 10: 78,955,781 D192G possibly damaging Het
Phf3 T C 1: 30,811,877 E1132G probably damaging Het
Pla2g4d A T 2: 120,270,633 M521K probably damaging Het
Plekhg1 A G 10: 3,963,770 H1164R possibly damaging Het
Plxnb2 A G 15: 89,160,389 V1218A probably benign Het
Pold1 A G 7: 44,542,206 S119P probably benign Het
Pole T A 5: 110,293,290 D203E probably benign Het
Rapgefl1 T A 11: 98,847,121 L387Q probably damaging Het
Rbm33 T C 5: 28,352,506 I199T probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 C A 11: 50,398,380 R545L probably benign Het
Ryr3 T A 2: 112,860,354 D1117V probably damaging Het
Sap130 T C 18: 31,682,088 V621A possibly damaging Het
Sparcl1 T A 5: 104,087,074 Y525F probably damaging Het
Spon2 A G 5: 33,216,427 V180A probably benign Het
Trav10n G A 14: 53,122,490 V75M probably benign Het
Ttc34 T C 4: 154,839,086 L84P probably damaging Het
Vmn1r23 C T 6: 57,926,145 R216K probably benign Het
Vmn2r61 A G 7: 42,299,940 T595A probably benign Het
Vmn2r66 T A 7: 85,012,008 I5F possibly damaging Het
Zfp879 C T 11: 50,833,012 G406R probably damaging Het
Zic2 A T 14: 122,476,457 D261V probably damaging Het
Other mutations in Gimap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Gimap9 APN 6 48677917 critical splice donor site probably null
IGL01568:Gimap9 APN 6 48677616 missense probably benign 0.07
R0442:Gimap9 UTSW 6 48678066 nonsense probably null
R1354:Gimap9 UTSW 6 48678048 missense probably benign 0.24
R2276:Gimap9 UTSW 6 48677878 missense probably benign 0.00
R6190:Gimap9 UTSW 6 48678351 missense probably damaging 1.00
R7116:Gimap9 UTSW 6 48678055 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGTCAGCTTGCCTTGACATGG -3'
(R):5'- ATCATGTACTTCAGGGCTGC -3'

Sequencing Primer
(F):5'- TGGCCAGGGAGACACTG -3'
(R):5'- GGGCTGCCTCCCCAAAAAG -3'
Posted On2018-11-06