Mutagenetix > Incidental Mutations

Incidental Mutation 'R6930:Herc3'

539940

Institutional Source

Beutler Lab

Gene Symbol

Herc3

Ensembl Gene

ENSMUSG00000029804

Gene Name

hect domain and RLD 3

Synonyms

5730409F18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6930 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58831465-58920398 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 58916459 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 902 (V902G)

Ref Sequence

ENSEMBL: ENSMUSP00000040025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041401]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041401
AA Change: V902G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000040025
Gene: ENSMUSG00000029804
AA Change: V902G

Domain	Start	End	E-Value	Type
Pfam:RCC1_2	36	65	1.7e-11	PFAM
Pfam:RCC1	52	99	1.6e-15	PFAM
Pfam:RCC1_2	86	115	1.1e-10	PFAM
Pfam:RCC1	102	152	7.3e-16	PFAM
Pfam:RCC1_2	139	168	1.3e-9	PFAM
Pfam:RCC1	155	205	1.4e-16	PFAM
Pfam:RCC1_2	193	221	5e-10	PFAM
Pfam:RCC1	208	257	1.4e-16	PFAM
Pfam:RCC1_2	244	273	6.1e-8	PFAM
Pfam:RCC1	260	309	1.7e-14	PFAM
Pfam:RCC1_2	296	326	1.1e-7	PFAM
Pfam:RCC1	313	377	6.6e-11	PFAM
HECTc	721	1050	5.79e-157	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member the HERC ubiquitin ligase family. The encoded protein is located in the cytosol and binds ubiquitin via a HECT domain. Mutations in this gene have been associated with colorectal and gastric carcinomas. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hair follicle bulge morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	A	T	11: 23,516,563	D156E	probably benign	Het
2010300C02Rik	A	T	1: 37,624,945	I624N	possibly damaging	Het
Adam17	A	T	12: 21,353,948	V99E	probably damaging	Het
Akr1e1	T	C	13: 4,602,715	D41G	probably damaging	Het
Alcam	T	C	16: 52,305,655	I100V	probably benign	Het
Atr	T	C	9: 95,866,635	I411T	probably benign	Het
Bbs4	T	C	9: 59,323,481	S453G	probably benign	Het
Brdt	C	T	5: 107,359,215	L494F	probably benign	Het
Ccser1	T	C	6: 62,380,025	S816P	probably benign	Het
Cdk10	T	C	8: 123,230,608	I157T	probably damaging	Het
Ceacam5	G	A	7: 17,750,834		probably null	Het
Chst15	T	C	7: 132,269,030	I259V	possibly damaging	Het
Csmd1	A	T	8: 16,092,395	M1498K	probably damaging	Het
D630045J12Rik	T	C	6: 38,158,216	D1343G	probably damaging	Het
Denr	T	C	5: 123,908,187	Y27H	probably benign	Het
Dopey1	T	C	9: 86,531,772		probably null	Het
Epg5	T	C	18: 78,014,163	F1819S	probably damaging	Het
Flg2	T	A	3: 93,201,335	Y223*	probably null	Het
Fry	T	C	5: 150,428,230	L1733P	probably benign	Het
Gabrb2	T	C	11: 42,597,613	V302A	probably damaging	Het
Gimap9	G	A	6: 48,677,667	D53N	probably damaging	Het
Gje1	G	T	10: 14,718,142	L3I	possibly damaging	Het
Gm49383	G	T	12: 69,192,812	A645E	probably damaging	Het
Gm8947	G	A	1: 151,192,596	G60D	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gys2	A	G	6: 142,459,380		probably null	Het
Hace1	A	G	10: 45,618,502	H136R	probably damaging	Het
Hspbp1	T	C	7: 4,684,607	R2G	probably benign	Het
Iqch	T	A	9: 63,480,574	K811N	possibly damaging	Het
Kmt2a	A	G	9: 44,842,665		probably benign	Het
Lonrf2	A	T	1: 38,804,336	V372D	probably benign	Het
Lpin2	T	C	17: 71,244,791	Y729H	probably damaging	Het
Lrrc32	A	G	7: 98,499,264	N417S	possibly damaging	Het
Malrd1	T	A	2: 15,797,667	C1064S	unknown	Het
Mast3	G	A	8: 70,799,471	R20*	probably null	Het
Mypn	A	C	10: 63,116,939	I174S	probably damaging	Het
Nrg1	G	A	8: 31,818,506	T505M	probably damaging	Het
Olfr1340	A	G	4: 118,727,141	K298R	probably damaging	Het
Olfr18	A	G	9: 20,314,099	Y266H	probably damaging	Het
Olfr220	A	G	1: 174,449,111	I163V	probably damaging	Het
Olfr8	A	G	10: 78,955,781	D192G	possibly damaging	Het
Phf3	T	C	1: 30,811,877	E1132G	probably damaging	Het
Pla2g4d	A	T	2: 120,270,633	M521K	probably damaging	Het
Plekhg1	A	G	10: 3,963,770	H1164R	possibly damaging	Het
Plxnb2	A	G	15: 89,160,389	V1218A	probably benign	Het
Pold1	A	G	7: 44,542,206	S119P	probably benign	Het
Pole	T	A	5: 110,293,290	D203E	probably benign	Het
Rapgefl1	T	A	11: 98,847,121	L387Q	probably damaging	Het
Rbm33	T	C	5: 28,352,506	I199T	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rufy1	C	A	11: 50,398,380	R545L	probably benign	Het
Ryr3	T	A	2: 112,860,354	D1117V	probably damaging	Het
Sap130	T	C	18: 31,682,088	V621A	possibly damaging	Het
Sparcl1	T	A	5: 104,087,074	Y525F	probably damaging	Het
Spon2	A	G	5: 33,216,427	V180A	probably benign	Het
Trav10n	G	A	14: 53,122,490	V75M	probably benign	Het
Ttc34	T	C	4: 154,839,086	L84P	probably damaging	Het
Vmn1r23	C	T	6: 57,926,145	R216K	probably benign	Het
Vmn2r61	A	G	7: 42,299,940	T595A	probably benign	Het
Vmn2r66	T	A	7: 85,012,008	I5F	possibly damaging	Het
Zfp879	C	T	11: 50,833,012	G406R	probably damaging	Het
Zic2	A	T	14: 122,476,457	D261V	probably damaging	Het

Other mutations in Herc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Herc3	APN	6	58874263	missense	probably damaging	1.00
IGL00423:Herc3	APN	6	58868715	missense	probably damaging	0.99
IGL00468:Herc3	APN	6	58918766	missense	probably benign	0.04
IGL01153:Herc3	APN	6	58860336	missense	probably benign	0.21
IGL01468:Herc3	APN	6	58854895	missense	probably benign	0.00
IGL01696:Herc3	APN	6	58860386	missense	possibly damaging	0.58
IGL01975:Herc3	APN	6	58916576	missense	possibly damaging	0.91
IGL02797:Herc3	APN	6	58868694	missense	probably benign
IGL02953:Herc3	APN	6	58857733	nonsense	probably null
aegean	UTSW	6	58855760	nonsense	probably null
PIT4519001:Herc3	UTSW	6	58876811	missense	probably damaging	1.00
R0019:Herc3	UTSW	6	58885065	splice site	probably benign
R0019:Herc3	UTSW	6	58885065	splice site	probably benign
R0025:Herc3	UTSW	6	58874308	missense	probably damaging	1.00
R0025:Herc3	UTSW	6	58874308	missense	probably damaging	1.00
R0268:Herc3	UTSW	6	58868628	splice site	probably benign
R0334:Herc3	UTSW	6	58918817	missense	probably damaging	1.00
R0344:Herc3	UTSW	6	58868628	splice site	probably benign
R0853:Herc3	UTSW	6	58876564	missense	probably damaging	1.00
R0927:Herc3	UTSW	6	58868763	missense	possibly damaging	0.48
R1333:Herc3	UTSW	6	58887493	missense	probably damaging	1.00
R1432:Herc3	UTSW	6	58916842	missense	possibly damaging	0.49
R1450:Herc3	UTSW	6	58876515	nonsense	probably null
R1594:Herc3	UTSW	6	58887584	unclassified	probably benign
R1757:Herc3	UTSW	6	58916470	missense	probably damaging	1.00
R1765:Herc3	UTSW	6	58888660	missense	probably damaging	0.99
R1932:Herc3	UTSW	6	58876793	missense	probably damaging	0.99
R1945:Herc3	UTSW	6	58887439	missense	probably damaging	0.96
R1988:Herc3	UTSW	6	58884975	critical splice donor site	probably null
R2172:Herc3	UTSW	6	58887437	missense	probably damaging	1.00
R3080:Herc3	UTSW	6	58856646	splice site	probably null
R3545:Herc3	UTSW	6	58856685	missense	probably damaging	1.00
R3767:Herc3	UTSW	6	58862988	missense	probably benign
R3767:Herc3	UTSW	6	58876602	missense	probably benign	0.00
R3805:Herc3	UTSW	6	58916850	missense	probably damaging	1.00
R3806:Herc3	UTSW	6	58916850	missense	probably damaging	1.00
R4049:Herc3	UTSW	6	58876837	missense	probably damaging	0.99
R4250:Herc3	UTSW	6	58916516	missense	probably damaging	1.00
R4469:Herc3	UTSW	6	58876809	nonsense	probably null
R4534:Herc3	UTSW	6	58860347	missense	probably benign
R4573:Herc3	UTSW	6	58894113	missense	possibly damaging	0.89
R4887:Herc3	UTSW	6	58887499	missense	probably damaging	1.00
R5047:Herc3	UTSW	6	58855760	nonsense	probably null
R5049:Herc3	UTSW	6	58894539	splice site	probably null
R5062:Herc3	UTSW	6	58855760	nonsense	probably null
R5063:Herc3	UTSW	6	58855760	nonsense	probably null
R5288:Herc3	UTSW	6	58874278	missense	probably damaging	0.99
R5297:Herc3	UTSW	6	58856641	missense	probably damaging	1.00
R5386:Herc3	UTSW	6	58874278	missense	probably damaging	0.99
R5435:Herc3	UTSW	6	58855806	missense	probably damaging	1.00
R5576:Herc3	UTSW	6	58888725	missense	probably benign	0.08
R5605:Herc3	UTSW	6	58857727	missense	probably damaging	1.00
R5719:Herc3	UTSW	6	58894543	missense	possibly damaging	0.67
R5743:Herc3	UTSW	6	58918799	missense	probably benign	0.12
R5870:Herc3	UTSW	6	58916450	missense	probably benign	0.01
R6460:Herc3	UTSW	6	58890123	missense	probably damaging	1.00
R7034:Herc3	UTSW	6	58876855	missense	probably benign	0.00
R7131:Herc3	UTSW	6	58887424	missense	probably damaging	1.00
R7187:Herc3	UTSW	6	58856631	missense	probably benign	0.42
R7212:Herc3	UTSW	6	58918773	missense	probably damaging	1.00
R7335:Herc3	UTSW	6	58876788	missense	possibly damaging	0.95
R7349:Herc3	UTSW	6	58858986	missense	probably benign
R7568:Herc3	UTSW	6	58843810	missense	probably benign	0.01
R7857:Herc3	UTSW	6	58843652	nonsense	probably null
R8321:Herc3	UTSW	6	58843769	missense	possibly damaging	0.93
R8672:Herc3	UTSW	6	58873801	missense	probably damaging	0.96
R8684:Herc3	UTSW	6	58887576	missense	probably damaging	1.00
Z1176:Herc3	UTSW	6	58843858	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TACTACAGGATGCAGGATGCC -3'
(R):5'- GGAGACCTCTAGCAACTACTCAAG -3'

Sequencing Primer
(F):5'- TGCCTGACAAAAGACTGTGTC -3'
(R):5'- ATGTGAAGACCAGGTCCTCTG -3'

Posted On

2018-11-06