Incidental Mutation 'R6930:Pold1'
ID539946
Institutional Source Beutler Lab
Gene Symbol Pold1
Ensembl Gene ENSMUSG00000038644
Gene Namepolymerase (DNA directed), delta 1, catalytic subunit
Synonyms125kDa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R6930 (G1)
Quality Score184.009
Status Validated
Chromosome7
Chromosomal Location44532746-44548849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44542206 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 119 (S119P)
Ref Sequence ENSEMBL: ENSMUSP00000117157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049343] [ENSMUST00000145956] [ENSMUST00000151793]
Predicted Effect probably benign
Transcript: ENSMUST00000049343
AA Change: S119P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039776
Gene: ENSMUSG00000038644
AA Change: S119P

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 2.53e-161 SMART
Blast:POLBc 790 837 1e-18 BLAST
Pfam:zf-C4pol 1010 1080 5.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145956
AA Change: S119P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117844
Gene: ENSMUSG00000038644
AA Change: S119P

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 2e-8 BLAST
PDB:3IAY|A 76 151 7e-8 PDB
SCOP:d1tgoa1 117 153 3e-10 SMART
Blast:POLBc 130 153 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151793
AA Change: S119P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117157
Gene: ENSMUSG00000038644
AA Change: S119P

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 66 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 7.8e-164 SMART
Blast:POLBc 790 837 1e-18 BLAST
low complexity region 914 938 N/A INTRINSIC
low complexity region 959 980 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have an elevated mutation rate as well as an increased incidence of tumors. Median age for these mice is around 10 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,516,563 D156E probably benign Het
2010300C02Rik A T 1: 37,624,945 I624N possibly damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Akr1e1 T C 13: 4,602,715 D41G probably damaging Het
Alcam T C 16: 52,305,655 I100V probably benign Het
Atr T C 9: 95,866,635 I411T probably benign Het
Bbs4 T C 9: 59,323,481 S453G probably benign Het
Brdt C T 5: 107,359,215 L494F probably benign Het
Ccser1 T C 6: 62,380,025 S816P probably benign Het
Cdk10 T C 8: 123,230,608 I157T probably damaging Het
Ceacam5 G A 7: 17,750,834 probably null Het
Chst15 T C 7: 132,269,030 I259V possibly damaging Het
Csmd1 A T 8: 16,092,395 M1498K probably damaging Het
D630045J12Rik T C 6: 38,158,216 D1343G probably damaging Het
Denr T C 5: 123,908,187 Y27H probably benign Het
Dopey1 T C 9: 86,531,772 probably null Het
Epg5 T C 18: 78,014,163 F1819S probably damaging Het
Flg2 T A 3: 93,201,335 Y223* probably null Het
Fry T C 5: 150,428,230 L1733P probably benign Het
Gabrb2 T C 11: 42,597,613 V302A probably damaging Het
Gimap9 G A 6: 48,677,667 D53N probably damaging Het
Gje1 G T 10: 14,718,142 L3I possibly damaging Het
Gm49383 G T 12: 69,192,812 A645E probably damaging Het
Gm8947 G A 1: 151,192,596 G60D probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gys2 A G 6: 142,459,380 probably null Het
Hace1 A G 10: 45,618,502 H136R probably damaging Het
Herc3 T G 6: 58,916,459 V902G probably damaging Het
Hspbp1 T C 7: 4,684,607 R2G probably benign Het
Iqch T A 9: 63,480,574 K811N possibly damaging Het
Kmt2a A G 9: 44,842,665 probably benign Het
Lonrf2 A T 1: 38,804,336 V372D probably benign Het
Lpin2 T C 17: 71,244,791 Y729H probably damaging Het
Lrrc32 A G 7: 98,499,264 N417S possibly damaging Het
Malrd1 T A 2: 15,797,667 C1064S unknown Het
Mast3 G A 8: 70,799,471 R20* probably null Het
Mypn A C 10: 63,116,939 I174S probably damaging Het
Nrg1 G A 8: 31,818,506 T505M probably damaging Het
Olfr1340 A G 4: 118,727,141 K298R probably damaging Het
Olfr18 A G 9: 20,314,099 Y266H probably damaging Het
Olfr220 A G 1: 174,449,111 I163V probably damaging Het
Olfr8 A G 10: 78,955,781 D192G possibly damaging Het
Phf3 T C 1: 30,811,877 E1132G probably damaging Het
Pla2g4d A T 2: 120,270,633 M521K probably damaging Het
Plekhg1 A G 10: 3,963,770 H1164R possibly damaging Het
Plxnb2 A G 15: 89,160,389 V1218A probably benign Het
Pole T A 5: 110,293,290 D203E probably benign Het
Rapgefl1 T A 11: 98,847,121 L387Q probably damaging Het
Rbm33 T C 5: 28,352,506 I199T probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 C A 11: 50,398,380 R545L probably benign Het
Ryr3 T A 2: 112,860,354 D1117V probably damaging Het
Sap130 T C 18: 31,682,088 V621A possibly damaging Het
Sparcl1 T A 5: 104,087,074 Y525F probably damaging Het
Spon2 A G 5: 33,216,427 V180A probably benign Het
Trav10n G A 14: 53,122,490 V75M probably benign Het
Ttc34 T C 4: 154,839,086 L84P probably damaging Het
Vmn1r23 C T 6: 57,926,145 R216K probably benign Het
Vmn2r61 A G 7: 42,299,940 T595A probably benign Het
Vmn2r66 T A 7: 85,012,008 I5F possibly damaging Het
Zfp879 C T 11: 50,833,012 G406R probably damaging Het
Zic2 A T 14: 122,476,457 D261V probably damaging Het
Other mutations in Pold1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Pold1 APN 7 44543232 splice site probably benign
IGL01626:Pold1 APN 7 44533372 critical splice donor site probably null
IGL01635:Pold1 APN 7 44535977 missense probably damaging 1.00
IGL02165:Pold1 APN 7 44538060 missense probably damaging 1.00
IGL02197:Pold1 APN 7 44542239 missense probably benign 0.07
IGL02579:Pold1 APN 7 44543279 missense probably damaging 1.00
IGL03104:Pold1 APN 7 44540580 missense probably damaging 1.00
IGL03118:Pold1 APN 7 44539400 missense probably benign 0.17
PIT4243001:Pold1 UTSW 7 44542158 missense possibly damaging 0.77
PIT4431001:Pold1 UTSW 7 44538894 missense probably damaging 1.00
R0184:Pold1 UTSW 7 44541715 missense probably benign 0.32
R0266:Pold1 UTSW 7 44541025 splice site probably benign
R0537:Pold1 UTSW 7 44535092 missense probably damaging 1.00
R1251:Pold1 UTSW 7 44535051 missense probably benign 0.02
R1348:Pold1 UTSW 7 44534682 missense probably benign 0.00
R1376:Pold1 UTSW 7 44540562 missense probably damaging 1.00
R1376:Pold1 UTSW 7 44540562 missense probably damaging 1.00
R1445:Pold1 UTSW 7 44542757 splice site probably benign
R2156:Pold1 UTSW 7 44539118 missense probably damaging 1.00
R2256:Pold1 UTSW 7 44533799 critical splice acceptor site probably null
R2259:Pold1 UTSW 7 44541484 splice site probably benign
R2870:Pold1 UTSW 7 44543347 synonymous silent
R3793:Pold1 UTSW 7 44541570 missense probably damaging 1.00
R4493:Pold1 UTSW 7 44537708 missense probably damaging 1.00
R4583:Pold1 UTSW 7 44538913 missense probably damaging 0.97
R4661:Pold1 UTSW 7 44532809 missense probably damaging 0.99
R4738:Pold1 UTSW 7 44541329 missense probably damaging 0.99
R4769:Pold1 UTSW 7 44535071 missense probably damaging 1.00
R4797:Pold1 UTSW 7 44541901 missense possibly damaging 0.91
R5009:Pold1 UTSW 7 44533902 missense probably benign 0.13
R5150:Pold1 UTSW 7 44535832 missense possibly damaging 0.91
R5534:Pold1 UTSW 7 44538619 missense probably damaging 1.00
R5988:Pold1 UTSW 7 44540580 missense probably damaging 1.00
R6113:Pold1 UTSW 7 44537700 missense probably damaging 1.00
R6127:Pold1 UTSW 7 44542121 missense probably damaging 1.00
R6232:Pold1 UTSW 7 44540842 critical splice donor site probably null
R6435:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6436:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6437:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R7049:Pold1 UTSW 7 44541371 missense possibly damaging 0.95
R7158:Pold1 UTSW 7 44538866 missense probably damaging 1.00
R7170:Pold1 UTSW 7 44542148 missense possibly damaging 0.93
R7235:Pold1 UTSW 7 44541820 missense probably benign 0.00
R7372:Pold1 UTSW 7 44543423 missense possibly damaging 0.59
R7511:Pold1 UTSW 7 44542190 missense possibly damaging 0.67
R7797:Pold1 UTSW 7 44541789 missense probably benign 0.00
Z1176:Pold1 UTSW 7 44541780 missense probably benign 0.15
Z1176:Pold1 UTSW 7 44542232 missense probably benign
Z1177:Pold1 UTSW 7 44541958 missense not run
Predicted Primers PCR Primer
(F):5'- TAGCTCTATTGCCAGCACTG -3'
(R):5'- CACTGTAATGCTGGCTCTGC -3'

Sequencing Primer
(F):5'- GCCCCAAAACCTGGTGTAG -3'
(R):5'- CTCTGCCTCTGGGTGGAGAAG -3'
Posted On2018-11-06