Mutagenetix > Incidental Mutations

Incidental Mutation 'R6930:Mast3'

539952

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6930 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 70799471 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 20 (R20*)

Ref Sequence

ENSEMBL: ENSMUSP00000148351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000212001] [ENSMUST00000212757] [ENSMUST00000212875]

Predicted Effect

probably benign
Transcript: ENSMUST00000166004

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000212001
AA Change: R20*

Predicted Effect

probably null
Transcript: ENSMUST00000212757
AA Change: R44*

Predicted Effect

probably null
Transcript: ENSMUST00000212875
AA Change: R20*

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.5%

Validation Efficiency

100% (63/63)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	A	T	11: 23,516,563	D156E	probably benign	Het
2010300C02Rik	A	T	1: 37,624,945	I624N	possibly damaging	Het
Adam17	A	T	12: 21,353,948	V99E	probably damaging	Het
Akr1e1	T	C	13: 4,602,715	D41G	probably damaging	Het
Alcam	T	C	16: 52,305,655	I100V	probably benign	Het
Atr	T	C	9: 95,866,635	I411T	probably benign	Het
Bbs4	T	C	9: 59,323,481	S453G	probably benign	Het
Brdt	C	T	5: 107,359,215	L494F	probably benign	Het
Ccser1	T	C	6: 62,380,025	S816P	probably benign	Het
Cdk10	T	C	8: 123,230,608	I157T	probably damaging	Het
Ceacam5	G	A	7: 17,750,834		probably null	Het
Chst15	T	C	7: 132,269,030	I259V	possibly damaging	Het
Csmd1	A	T	8: 16,092,395	M1498K	probably damaging	Het
D630045J12Rik	T	C	6: 38,158,216	D1343G	probably damaging	Het
Denr	T	C	5: 123,908,187	Y27H	probably benign	Het
Dopey1	T	C	9: 86,531,772		probably null	Het
Epg5	T	C	18: 78,014,163	F1819S	probably damaging	Het
Flg2	T	A	3: 93,201,335	Y223*	probably null	Het
Fry	T	C	5: 150,428,230	L1733P	probably benign	Het
Gabrb2	T	C	11: 42,597,613	V302A	probably damaging	Het
Gimap9	G	A	6: 48,677,667	D53N	probably damaging	Het
Gje1	G	T	10: 14,718,142	L3I	possibly damaging	Het
Gm49383	G	T	12: 69,192,812	A645E	probably damaging	Het
Gm8947	G	A	1: 151,192,596	G60D	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gys2	A	G	6: 142,459,380		probably null	Het
Hace1	A	G	10: 45,618,502	H136R	probably damaging	Het
Herc3	T	G	6: 58,916,459	V902G	probably damaging	Het
Hspbp1	T	C	7: 4,684,607	R2G	probably benign	Het
Iqch	T	A	9: 63,480,574	K811N	possibly damaging	Het
Kmt2a	A	G	9: 44,842,665		probably benign	Het
Lonrf2	A	T	1: 38,804,336	V372D	probably benign	Het
Lpin2	T	C	17: 71,244,791	Y729H	probably damaging	Het
Lrrc32	A	G	7: 98,499,264	N417S	possibly damaging	Het
Malrd1	T	A	2: 15,797,667	C1064S	unknown	Het
Mypn	A	C	10: 63,116,939	I174S	probably damaging	Het
Nrg1	G	A	8: 31,818,506	T505M	probably damaging	Het
Olfr1340	A	G	4: 118,727,141	K298R	probably damaging	Het
Olfr18	A	G	9: 20,314,099	Y266H	probably damaging	Het
Olfr220	A	G	1: 174,449,111	I163V	probably damaging	Het
Olfr8	A	G	10: 78,955,781	D192G	possibly damaging	Het
Phf3	T	C	1: 30,811,877	E1132G	probably damaging	Het
Pla2g4d	A	T	2: 120,270,633	M521K	probably damaging	Het
Plekhg1	A	G	10: 3,963,770	H1164R	possibly damaging	Het
Plxnb2	A	G	15: 89,160,389	V1218A	probably benign	Het
Pold1	A	G	7: 44,542,206	S119P	probably benign	Het
Pole	T	A	5: 110,293,290	D203E	probably benign	Het
Rapgefl1	T	A	11: 98,847,121	L387Q	probably damaging	Het
Rbm33	T	C	5: 28,352,506	I199T	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rufy1	C	A	11: 50,398,380	R545L	probably benign	Het
Ryr3	T	A	2: 112,860,354	D1117V	probably damaging	Het
Sap130	T	C	18: 31,682,088	V621A	possibly damaging	Het
Sparcl1	T	A	5: 104,087,074	Y525F	probably damaging	Het
Spon2	A	G	5: 33,216,427	V180A	probably benign	Het
Trav10n	G	A	14: 53,122,490	V75M	probably benign	Het
Ttc34	T	C	4: 154,839,086	L84P	probably damaging	Het
Vmn1r23	C	T	6: 57,926,145	R216K	probably benign	Het
Vmn2r61	A	G	7: 42,299,940	T595A	probably benign	Het
Vmn2r66	T	A	7: 85,012,008	I5F	possibly damaging	Het
Zfp879	C	T	11: 50,833,012	G406R	probably damaging	Het
Zic2	A	T	14: 122,476,457	D261V	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGCTCAGTGGTTAAAGCGATTG -3'
(R):5'- TCAGAGTAAGGACTAAGCCACTG -3'

Sequencing Primer
(F):5'- TGCTAATGATAAGGAGTTCAGGGTC -3'
(R):5'- GAGTAAGGACTAAGCCACTGAACATC -3'

Posted On

2018-11-06