Incidental Mutation 'R6930:Hace1'
ID539962
Institutional Source Beutler Lab
Gene Symbol Hace1
Ensembl Gene ENSMUSG00000038822
Gene NameHECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
SynonymsA730034A22Rik, 1700042J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R6930 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location45577829-45712345 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45618502 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 136 (H136R)
Ref Sequence ENSEMBL: ENSMUSP00000039206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037044]
Predicted Effect probably damaging
Transcript: ENSMUST00000037044
AA Change: H136R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039206
Gene: ENSMUSG00000038822
AA Change: H136R

DomainStartEndE-ValueType
ANK 64 93 3.23e-4 SMART
ANK 97 126 7.76e-7 SMART
ANK 130 159 8.26e-2 SMART
ANK 163 192 1.94e-7 SMART
ANK 196 227 1.65e-1 SMART
ANK 228 257 5.98e1 SMART
Blast:HECTc 372 522 7e-87 BLAST
HECTc 572 909 1.76e-138 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.5%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HECT domain and ankyrin repeat-containing ubiquitin ligase. The encoded protein is involved in specific tagging of target proteins, leading to their subcellular localization or proteasomal degradation. The protein is a potential tumor suppressor and is involved in the pathophysiology of several tumors, including Wilm's tumor. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased spontaneous and induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,516,563 D156E probably benign Het
2010300C02Rik A T 1: 37,624,945 I624N possibly damaging Het
Adam17 A T 12: 21,353,948 V99E probably damaging Het
Akr1e1 T C 13: 4,602,715 D41G probably damaging Het
Alcam T C 16: 52,305,655 I100V probably benign Het
Atr T C 9: 95,866,635 I411T probably benign Het
Bbs4 T C 9: 59,323,481 S453G probably benign Het
Brdt C T 5: 107,359,215 L494F probably benign Het
Ccser1 T C 6: 62,380,025 S816P probably benign Het
Cdk10 T C 8: 123,230,608 I157T probably damaging Het
Ceacam5 G A 7: 17,750,834 probably null Het
Chst15 T C 7: 132,269,030 I259V possibly damaging Het
Csmd1 A T 8: 16,092,395 M1498K probably damaging Het
D630045J12Rik T C 6: 38,158,216 D1343G probably damaging Het
Denr T C 5: 123,908,187 Y27H probably benign Het
Dopey1 T C 9: 86,531,772 probably null Het
Epg5 T C 18: 78,014,163 F1819S probably damaging Het
Flg2 T A 3: 93,201,335 Y223* probably null Het
Fry T C 5: 150,428,230 L1733P probably benign Het
Gabrb2 T C 11: 42,597,613 V302A probably damaging Het
Gimap9 G A 6: 48,677,667 D53N probably damaging Het
Gje1 G T 10: 14,718,142 L3I possibly damaging Het
Gm49383 G T 12: 69,192,812 A645E probably damaging Het
Gm8947 G A 1: 151,192,596 G60D probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gys2 A G 6: 142,459,380 probably null Het
Herc3 T G 6: 58,916,459 V902G probably damaging Het
Hspbp1 T C 7: 4,684,607 R2G probably benign Het
Iqch T A 9: 63,480,574 K811N possibly damaging Het
Kmt2a A G 9: 44,842,665 probably benign Het
Lonrf2 A T 1: 38,804,336 V372D probably benign Het
Lpin2 T C 17: 71,244,791 Y729H probably damaging Het
Lrrc32 A G 7: 98,499,264 N417S possibly damaging Het
Malrd1 T A 2: 15,797,667 C1064S unknown Het
Mast3 G A 8: 70,799,471 R20* probably null Het
Mypn A C 10: 63,116,939 I174S probably damaging Het
Nrg1 G A 8: 31,818,506 T505M probably damaging Het
Olfr1340 A G 4: 118,727,141 K298R probably damaging Het
Olfr18 A G 9: 20,314,099 Y266H probably damaging Het
Olfr220 A G 1: 174,449,111 I163V probably damaging Het
Olfr8 A G 10: 78,955,781 D192G possibly damaging Het
Phf3 T C 1: 30,811,877 E1132G probably damaging Het
Pla2g4d A T 2: 120,270,633 M521K probably damaging Het
Plekhg1 A G 10: 3,963,770 H1164R possibly damaging Het
Plxnb2 A G 15: 89,160,389 V1218A probably benign Het
Pold1 A G 7: 44,542,206 S119P probably benign Het
Pole T A 5: 110,293,290 D203E probably benign Het
Rapgefl1 T A 11: 98,847,121 L387Q probably damaging Het
Rbm33 T C 5: 28,352,506 I199T probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 C A 11: 50,398,380 R545L probably benign Het
Ryr3 T A 2: 112,860,354 D1117V probably damaging Het
Sap130 T C 18: 31,682,088 V621A possibly damaging Het
Sparcl1 T A 5: 104,087,074 Y525F probably damaging Het
Spon2 A G 5: 33,216,427 V180A probably benign Het
Trav10n G A 14: 53,122,490 V75M probably benign Het
Ttc34 T C 4: 154,839,086 L84P probably damaging Het
Vmn1r23 C T 6: 57,926,145 R216K probably benign Het
Vmn2r61 A G 7: 42,299,940 T595A probably benign Het
Vmn2r66 T A 7: 85,012,008 I5F possibly damaging Het
Zfp879 C T 11: 50,833,012 G406R probably damaging Het
Zic2 A T 14: 122,476,457 D261V probably damaging Het
Other mutations in Hace1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Hace1 APN 10 45672357 nonsense probably null
IGL01456:Hace1 APN 10 45709998 splice site probably benign
IGL02122:Hace1 APN 10 45618604 missense probably damaging 1.00
IGL02217:Hace1 APN 10 45590375 splice site probably null
IGL02493:Hace1 APN 10 45588419 missense probably damaging 0.98
IGL02596:Hace1 APN 10 45700640 missense possibly damaging 0.55
IGL02619:Hace1 APN 10 45671434 unclassified probably benign
IGL03163:Hace1 APN 10 45672605 missense probably damaging 0.97
R0609:Hace1 UTSW 10 45648869 missense probably damaging 1.00
R0853:Hace1 UTSW 10 45648683 missense probably damaging 1.00
R2038:Hace1 UTSW 10 45700625 missense probably benign 0.03
R2212:Hace1 UTSW 10 45648675 missense possibly damaging 0.50
R2328:Hace1 UTSW 10 45648945 missense probably benign 0.43
R2881:Hace1 UTSW 10 45671134 missense probably benign 0.10
R3005:Hace1 UTSW 10 45648863 missense probably damaging 0.96
R3414:Hace1 UTSW 10 45648675 missense possibly damaging 0.50
R3930:Hace1 UTSW 10 45711508 missense probably benign 0.37
R4014:Hace1 UTSW 10 45588374 splice site probably benign
R4335:Hace1 UTSW 10 45709961 missense probably damaging 0.99
R4547:Hace1 UTSW 10 45672555 unclassified probably null
R4812:Hace1 UTSW 10 45686603 missense probably benign 0.00
R4996:Hace1 UTSW 10 45649950 missense probably benign 0.17
R5858:Hace1 UTSW 10 45711525 missense possibly damaging 0.58
R5995:Hace1 UTSW 10 45670391 missense probably benign 0.00
R6049:Hace1 UTSW 10 45686662 missense probably damaging 1.00
R6111:Hace1 UTSW 10 45589510 missense possibly damaging 0.92
R6195:Hace1 UTSW 10 45670443 missense possibly damaging 0.70
R6216:Hace1 UTSW 10 45618547 missense probably benign
R6233:Hace1 UTSW 10 45670443 missense possibly damaging 0.70
R6237:Hace1 UTSW 10 45648890 missense probably benign
R6467:Hace1 UTSW 10 45590266 critical splice acceptor site probably null
R7325:Hace1 UTSW 10 45589507 nonsense probably null
R7401:Hace1 UTSW 10 45670626 missense probably damaging 1.00
R7426:Hace1 UTSW 10 45605540 missense probably damaging 1.00
R7471:Hace1 UTSW 10 45700979 missense probably benign 0.06
R7533:Hace1 UTSW 10 45711474 missense probably benign 0.03
R7661:Hace1 UTSW 10 45605553 missense probably damaging 1.00
R7873:Hace1 UTSW 10 45672787 missense possibly damaging 0.92
R7956:Hace1 UTSW 10 45672787 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GTAGCCAACATCTTGATGCATG -3'
(R):5'- GATAGAATGCTCATCACAAGTCC -3'

Sequencing Primer
(F):5'- GTGTTTTTCTCATGTAAAAGCACGG -3'
(R):5'- GCTCATCACAAGTCCATACAAAATAG -3'
Posted On2018-11-06