Mutagenetix > Incidental Mutations

Incidental Mutation 'R6930:Plxnb2'

539976

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R6930 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89160389 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1218 (V1218A)

Ref Sequence

ENSEMBL: ENSMUSP00000104955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

AlphaFold

B2RXS4

Predicted Effect

probably benign
Transcript: ENSMUST00000060808
AA Change: V1218A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: V1218A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109331
AA Change: V1218A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: V1218A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 99.0%
20x: 96.5%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	A	T	11: 23,516,563	D156E	probably benign	Het
2010300C02Rik	A	T	1: 37,624,945	I624N	possibly damaging	Het
Adam17	A	T	12: 21,353,948	V99E	probably damaging	Het
Akr1e1	T	C	13: 4,602,715	D41G	probably damaging	Het
Alcam	T	C	16: 52,305,655	I100V	probably benign	Het
Atr	T	C	9: 95,866,635	I411T	probably benign	Het
Bbs4	T	C	9: 59,323,481	S453G	probably benign	Het
Brdt	C	T	5: 107,359,215	L494F	probably benign	Het
Ccser1	T	C	6: 62,380,025	S816P	probably benign	Het
Cdk10	T	C	8: 123,230,608	I157T	probably damaging	Het
Ceacam5	G	A	7: 17,750,834		probably null	Het
Chst15	T	C	7: 132,269,030	I259V	possibly damaging	Het
Csmd1	A	T	8: 16,092,395	M1498K	probably damaging	Het
D630045J12Rik	T	C	6: 38,158,216	D1343G	probably damaging	Het
Denr	T	C	5: 123,908,187	Y27H	probably benign	Het
Dopey1	T	C	9: 86,531,772		probably null	Het
Epg5	T	C	18: 78,014,163	F1819S	probably damaging	Het
Flg2	T	A	3: 93,201,335	Y223*	probably null	Het
Fry	T	C	5: 150,428,230	L1733P	probably benign	Het
Gabrb2	T	C	11: 42,597,613	V302A	probably damaging	Het
Gimap9	G	A	6: 48,677,667	D53N	probably damaging	Het
Gje1	G	T	10: 14,718,142	L3I	possibly damaging	Het
Gm49383	G	T	12: 69,192,812	A645E	probably damaging	Het
Gm8947	G	A	1: 151,192,596	G60D	probably damaging	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Gys2	A	G	6: 142,459,380		probably null	Het
Hace1	A	G	10: 45,618,502	H136R	probably damaging	Het
Herc3	T	G	6: 58,916,459	V902G	probably damaging	Het
Hspbp1	T	C	7: 4,684,607	R2G	probably benign	Het
Iqch	T	A	9: 63,480,574	K811N	possibly damaging	Het
Kmt2a	A	G	9: 44,842,665		probably benign	Het
Lonrf2	A	T	1: 38,804,336	V372D	probably benign	Het
Lpin2	T	C	17: 71,244,791	Y729H	probably damaging	Het
Lrrc32	A	G	7: 98,499,264	N417S	possibly damaging	Het
Malrd1	T	A	2: 15,797,667	C1064S	unknown	Het
Mast3	G	A	8: 70,799,471	R20*	probably null	Het
Mypn	A	C	10: 63,116,939	I174S	probably damaging	Het
Nrg1	G	A	8: 31,818,506	T505M	probably damaging	Het
Olfr1340	A	G	4: 118,727,141	K298R	probably damaging	Het
Olfr18	A	G	9: 20,314,099	Y266H	probably damaging	Het
Olfr220	A	G	1: 174,449,111	I163V	probably damaging	Het
Olfr8	A	G	10: 78,955,781	D192G	possibly damaging	Het
Phf3	T	C	1: 30,811,877	E1132G	probably damaging	Het
Pla2g4d	A	T	2: 120,270,633	M521K	probably damaging	Het
Plekhg1	A	G	10: 3,963,770	H1164R	possibly damaging	Het
Pold1	A	G	7: 44,542,206	S119P	probably benign	Het
Pole	T	A	5: 110,293,290	D203E	probably benign	Het
Rapgefl1	T	A	11: 98,847,121	L387Q	probably damaging	Het
Rbm33	T	C	5: 28,352,506	I199T	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rufy1	C	A	11: 50,398,380	R545L	probably benign	Het
Ryr3	T	A	2: 112,860,354	D1117V	probably damaging	Het
Sap130	T	C	18: 31,682,088	V621A	possibly damaging	Het
Sparcl1	T	A	5: 104,087,074	Y525F	probably damaging	Het
Spon2	A	G	5: 33,216,427	V180A	probably benign	Het
Trav10n	G	A	14: 53,122,490	V75M	probably benign	Het
Ttc34	T	C	4: 154,839,086	L84P	probably damaging	Het
Vmn1r23	C	T	6: 57,926,145	R216K	probably benign	Het
Vmn2r61	A	G	7: 42,299,940	T595A	probably benign	Het
Vmn2r66	T	A	7: 85,012,008	I5F	possibly damaging	Het
Zfp879	C	T	11: 50,833,012	G406R	probably damaging	Het
Zic2	A	T	14: 122,476,457	D261V	probably damaging	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1530:Plxnb2	UTSW	15	89167192	missense	probably benign
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R8736:Plxnb2	UTSW	15	89162058	missense	probably damaging	1.00
R8772:Plxnb2	UTSW	15	89162746	missense	probably damaging	1.00
R9022:Plxnb2	UTSW	15	89164268	missense	possibly damaging	0.59
R9253:Plxnb2	UTSW	15	89167812	missense	probably benign
R9398:Plxnb2	UTSW	15	89160919	missense	probably benign	0.02
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTGGGATTTGATCTTCTCGTAC -3'
(R):5'- AGTTCATTGTGCGTGAGAGC -3'

Sequencing Primer
(F):5'- GGATTTGATCTTCTCGTACTCGCG -3'
(R):5'- TGGGGAGCCTCTCAGGAG -3'

Posted On

2018-11-06