Incidental Mutation 'R6931:Hnrnpu'
ID539985
Institutional Source Beutler Lab
Gene Symbol Hnrnpu
Ensembl Gene ENSMUSG00000039630
Gene Nameheterogeneous nuclear ribonucleoprotein U
SynonymsHnrpu, scaffold attachment factor A, Sp120
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6931 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location178321108-178337797 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 178331432 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000037748] [ENSMUST00000161769]
Predicted Effect unknown
Transcript: ENSMUST00000037748
AA Change: T530A
SMART Domains Protein: ENSMUSP00000047571
Gene: ENSMUSG00000039630
AA Change: T530A

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 2e-30 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 791 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161769
AA Change: T530A
SMART Domains Protein: ENSMUSP00000124147
Gene: ENSMUSG00000039630
AA Change: T530A

DomainStartEndE-ValueType
SAP 8 42 3.57e-11 SMART
low complexity region 70 96 N/A INTRINSIC
low complexity region 101 154 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
SPRY 307 439 2.35e-34 SMART
Pfam:AAA_33 475 619 6.7e-31 PFAM
coiled coil region 626 653 N/A INTRINSIC
low complexity region 657 675 N/A INTRINSIC
low complexity region 676 732 N/A INTRINSIC
low complexity region 736 750 N/A INTRINSIC
low complexity region 753 773 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188044
Predicted Effect probably benign
Transcript: ENSMUST00000189450
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they form complexes with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene contains a RNA binding domain and scaffold-associated region (SAR)-specific bipartite DNA-binding domain. This protein is also thought to be involved in the packaging of hnRNA into large ribonucleoprotein complexes. During apoptosis, this protein is cleaved in a caspase-dependent way. Cleavage occurs at the SALD site, resulting in a loss of DNA-binding activity and a concomitant detachment of this protein from nuclear structural sites. But this cleavage does not affect the function of the encoded protein in RNA metabolism. At least two alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality, delayed embryonic development, and failure of chorioallantoic fusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,548 T172A possibly damaging Het
2310003L06Rik T A 5: 87,970,702 I15N probably damaging Het
2900092C05Rik T A 7: 12,512,596 S6R unknown Het
Abca6 T A 11: 110,244,328 L210F probably benign Het
Abcc4 T C 14: 118,527,988 Q919R probably damaging Het
Adcy1 A G 11: 7,150,884 D811G possibly damaging Het
Akna A G 4: 63,387,102 S476P probably benign Het
Ankrd49 T C 9: 14,782,826 N15S probably benign Het
Apcdd1 A G 18: 62,933,908 D31G probably damaging Het
Aplp1 G T 7: 30,443,200 R106S probably damaging Het
Arhgap40 T C 2: 158,531,218 L132S probably benign Het
Atp8b5 G T 4: 43,364,108 probably null Het
Axl T C 7: 25,761,433 D717G probably damaging Het
Bub1 T A 2: 127,801,382 D1014V probably damaging Het
Cacna2d4 T A 6: 119,282,234 V603E possibly damaging Het
Cnot11 G C 1: 39,539,921 C289S probably damaging Het
Coasy A G 11: 101,083,581 H191R probably benign Het
Cyp11a1 A T 9: 58,025,120 N341Y possibly damaging Het
Cyp1a2 T C 9: 57,682,156 N125S probably benign Het
Cyp2j8 A T 4: 96,444,781 probably null Het
Dnah9 A T 11: 66,117,626 I791K possibly damaging Het
Ecm2 A T 13: 49,529,011 Q505H probably benign Het
Fam135a T A 1: 24,085,487 M1L probably damaging Het
Fam171a2 A G 11: 102,438,434 S500P possibly damaging Het
Fat3 A G 9: 15,959,942 S3718P possibly damaging Het
Frem1 G A 4: 82,970,677 P1085S probably damaging Het
Gcfc2 A G 6: 81,942,985 I390V probably benign Het
Gemin4 A G 11: 76,210,956 L993P probably damaging Het
Ggnbp2 T A 11: 84,833,167 D647V probably damaging Het
Gm7534 A T 4: 134,193,153 M567K probably benign Het
Gpr84 A C 15: 103,309,014 L212R probably damaging Het
Hspg2 G T 4: 137,540,720 C2116F probably damaging Het
Icam4 T A 9: 21,030,451 V249E probably damaging Het
Itga1 T C 13: 115,001,563 N429D probably benign Het
Kcns1 T C 2: 164,164,838 T402A probably damaging Het
Ky T A 9: 102,537,627 V246E probably damaging Het
March1 A G 8: 66,468,492 T529A probably benign Het
Med18 C G 4: 132,459,883 V102L probably damaging Het
Mlst8 T C 17: 24,477,275 D160G probably damaging Het
Mthfd1 T C 12: 76,303,698 I470T probably benign Het
Muc1 C T 3: 89,229,159 probably benign Het
Mup8 G A 4: 60,220,322 L137F probably damaging Het
Mybpc1 A T 10: 88,542,330 L341* probably null Het
Nacad A G 11: 6,601,877 F438S probably benign Het
Necap2 C A 4: 141,078,212 probably null Het
Nifk T C 1: 118,332,348 L163S possibly damaging Het
Npsr1 A G 9: 24,289,997 I73V probably benign Het
Olfr1179 G A 2: 88,402,064 T290I probably benign Het
Olfr1186 T A 2: 88,526,194 C204S possibly damaging Het
Olfr142 A T 2: 90,252,777 C70* probably null Het
Olfr715 A G 7: 107,128,901 L164P probably damaging Het
Oog3 C T 4: 144,159,353 C225Y probably benign Het
Plagl2 C A 2: 153,235,943 K39N probably benign Het
Plcg2 T A 8: 117,557,319 D118E probably benign Het
Ppp4r3b A T 11: 29,211,786 K720I possibly damaging Het
Prmt3 A T 7: 49,829,016 T442S probably benign Het
Prr14l G A 5: 32,830,691 H487Y probably damaging Het
Psmb3 G A 11: 97,703,971 V63I probably benign Het
Psmc6 T A 14: 45,343,725 I326K possibly damaging Het
Ptcd1 T C 5: 145,155,075 T405A probably benign Het
Rbm33 G A 5: 28,410,745 V29M probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scarb1 T A 5: 125,284,719 I107F probably damaging Het
Slc39a12 A G 2: 14,389,375 S19G probably benign Het
Slc44a5 T C 3: 154,258,506 V503A probably benign Het
Slc9a9 T C 9: 94,670,086 S9P possibly damaging Het
Snrnp35 A C 5: 124,490,701 R192S possibly damaging Het
Tbx15 T C 3: 99,352,151 L446P probably damaging Het
Tlnrd1 A G 7: 83,882,597 F209L probably benign Het
Tmprss12 C T 15: 100,285,268 R164C probably damaging Het
Tnfsf4 T A 1: 161,417,073 F111Y possibly damaging Het
Trib2 A T 12: 15,793,639 M198K probably benign Het
Ttll8 A G 15: 88,914,304 S743P possibly damaging Het
Ush2a A T 1: 188,728,383 N2614Y probably benign Het
Usp6nl G A 2: 6,430,458 V343I possibly damaging Het
Vrtn C A 12: 84,650,242 Q589K probably benign Het
Zbed5 T A 5: 129,903,329 Y706* probably null Het
Zc3h10 A G 10: 128,544,684 V268A probably damaging Het
Zfp442 C T 2: 150,410,940 probably null Het
Other mutations in Hnrnpu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03117:Hnrnpu APN 1 178330774 unclassified probably benign
R1136:Hnrnpu UTSW 1 178331225 unclassified probably benign
R1205:Hnrnpu UTSW 1 178332169 unclassified probably benign
R1317:Hnrnpu UTSW 1 178330257 unclassified probably benign
R1318:Hnrnpu UTSW 1 178330257 unclassified probably benign
R1778:Hnrnpu UTSW 1 178325241 critical splice donor site probably benign
R3160:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3161:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3162:Hnrnpu UTSW 1 178331125 unclassified probably benign
R3162:Hnrnpu UTSW 1 178331125 unclassified probably benign
R4408:Hnrnpu UTSW 1 178330803 unclassified probably benign
R4667:Hnrnpu UTSW 1 178332181 unclassified probably benign
R4833:Hnrnpu UTSW 1 178333894 unclassified probably benign
R4906:Hnrnpu UTSW 1 178329373 intron probably benign
R4923:Hnrnpu UTSW 1 178331452 unclassified probably benign
R5000:Hnrnpu UTSW 1 178329376 intron probably benign
R5256:Hnrnpu UTSW 1 178335893 missense unknown
R5307:Hnrnpu UTSW 1 178337312 missense unknown
R5911:Hnrnpu UTSW 1 178330172 unclassified probably benign
R7061:Hnrnpu UTSW 1 178336126 missense unknown
R7077:Hnrnpu UTSW 1 178332191 missense unknown
R7391:Hnrnpu UTSW 1 178337078 missense unknown
R7423:Hnrnpu UTSW 1 178329284 intron probably benign
R8037:Hnrnpu UTSW 1 178332352 missense unknown
Z1176:Hnrnpu UTSW 1 178332215 missense unknown
Predicted Primers PCR Primer
(F):5'- GCAGCAGCAGACACATTTG -3'
(R):5'- ACAGGGTCAGAAATTATCCTGGG -3'

Sequencing Primer
(F):5'- CACATTTGTCTTGAGGGGAAAATG -3'
(R):5'- GGTCAGAAATTATCCTGGGTTAATG -3'
Posted On2018-11-06