Incidental Mutation 'R6931:Tbx15'
ID 539999
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 045326-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.930) question?
Stock # R6931 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99259467 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 446 (L446P)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
AlphaFold O70306
Predicted Effect probably damaging
Transcript: ENSMUST00000029462
AA Change: L446P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: L446P

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 88,118,561 (GRCm39) I15N probably damaging Het
2900092C05Rik T A 7: 12,246,523 (GRCm39) S6R unknown Het
Abca6 T A 11: 110,135,154 (GRCm39) L210F probably benign Het
Abcc4 T C 14: 118,765,400 (GRCm39) Q919R probably damaging Het
Adcy1 A G 11: 7,100,884 (GRCm39) D811G possibly damaging Het
Akna A G 4: 63,305,339 (GRCm39) S476P probably benign Het
Ankrd49 T C 9: 14,694,122 (GRCm39) N15S probably benign Het
Apcdd1 A G 18: 63,066,979 (GRCm39) D31G probably damaging Het
Aplp1 G T 7: 30,142,625 (GRCm39) R106S probably damaging Het
Arhgap40 T C 2: 158,373,138 (GRCm39) L132S probably benign Het
Atp8b5 G T 4: 43,364,108 (GRCm39) probably null Het
Axl T C 7: 25,460,858 (GRCm39) D717G probably damaging Het
Bub1 T A 2: 127,643,302 (GRCm39) D1014V probably damaging Het
Cacna2d4 T A 6: 119,259,195 (GRCm39) V603E possibly damaging Het
Cnot11 G C 1: 39,579,002 (GRCm39) C289S probably damaging Het
Coasy A G 11: 100,974,407 (GRCm39) H191R probably benign Het
Cyp11a1 A T 9: 57,932,403 (GRCm39) N341Y possibly damaging Het
Cyp1a2 T C 9: 57,589,439 (GRCm39) N125S probably benign Het
Cyp2j8 A T 4: 96,333,018 (GRCm39) probably null Het
Dnah9 A T 11: 66,008,452 (GRCm39) I791K possibly damaging Het
Ecm2 A T 13: 49,682,487 (GRCm39) Q505H probably benign Het
Fam135a T A 1: 24,124,568 (GRCm39) M1L probably damaging Het
Fam171a2 A G 11: 102,329,260 (GRCm39) S500P possibly damaging Het
Fat3 A G 9: 15,871,238 (GRCm39) S3718P possibly damaging Het
Frem1 G A 4: 82,888,914 (GRCm39) P1085S probably damaging Het
Gcfc2 A G 6: 81,919,966 (GRCm39) I390V probably benign Het
Gemin4 A G 11: 76,101,782 (GRCm39) L993P probably damaging Het
Ggnbp2 T A 11: 84,723,993 (GRCm39) D647V probably damaging Het
Gpr84 A C 15: 103,217,441 (GRCm39) L212R probably damaging Het
Hnrnpu T C 1: 178,158,997 (GRCm39) probably benign Het
Hspg2 G T 4: 137,268,031 (GRCm39) C2116F probably damaging Het
Icam4 T A 9: 20,941,747 (GRCm39) V249E probably damaging Het
Itga1 T C 13: 115,138,099 (GRCm39) N429D probably benign Het
Kcns1 T C 2: 164,006,758 (GRCm39) T402A probably damaging Het
Ky T A 9: 102,414,826 (GRCm39) V246E probably damaging Het
Marchf1 A G 8: 66,921,144 (GRCm39) T529A probably benign Het
Med18 C G 4: 132,187,194 (GRCm39) V102L probably damaging Het
Mlst8 T C 17: 24,696,249 (GRCm39) D160G probably damaging Het
Mthfd1 T C 12: 76,350,472 (GRCm39) I470T probably benign Het
Muc1 C T 3: 89,136,466 (GRCm39) probably benign Het
Mup8 G A 4: 60,220,322 (GRCm39) L137F probably damaging Het
Mybpc1 A T 10: 88,378,192 (GRCm39) L341* probably null Het
Nacad A G 11: 6,551,877 (GRCm39) F438S probably benign Het
Necap2 C A 4: 140,805,523 (GRCm39) probably null Het
Nifk T C 1: 118,260,078 (GRCm39) L163S possibly damaging Het
Npsr1 A G 9: 24,201,293 (GRCm39) I73V probably benign Het
Nup50l T C 6: 96,142,529 (GRCm39) T172A possibly damaging Het
Oog3 C T 4: 143,885,923 (GRCm39) C225Y probably benign Het
Or2d2 A G 7: 106,728,108 (GRCm39) L164P probably damaging Het
Or4b13 A T 2: 90,083,121 (GRCm39) C70* probably null Het
Or4c100 T A 2: 88,356,538 (GRCm39) C204S possibly damaging Het
Or4p18 G A 2: 88,232,408 (GRCm39) T290I probably benign Het
Plagl2 C A 2: 153,077,863 (GRCm39) K39N probably benign Het
Plcg2 T A 8: 118,284,058 (GRCm39) D118E probably benign Het
Ppp4r3b A T 11: 29,161,786 (GRCm39) K720I possibly damaging Het
Prmt3 A T 7: 49,478,764 (GRCm39) T442S probably benign Het
Prr14l G A 5: 32,988,035 (GRCm39) H487Y probably damaging Het
Psmb3 G A 11: 97,594,797 (GRCm39) V63I probably benign Het
Psmc6 T A 14: 45,581,182 (GRCm39) I326K possibly damaging Het
Ptcd1 T C 5: 145,091,885 (GRCm39) T405A probably benign Het
Rbm33 G A 5: 28,615,743 (GRCm39) V29M probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Scarb1 T A 5: 125,361,783 (GRCm39) I107F probably damaging Het
Slc39a12 A G 2: 14,394,186 (GRCm39) S19G probably benign Het
Slc44a5 T C 3: 153,964,143 (GRCm39) V503A probably benign Het
Slc9a9 T C 9: 94,552,139 (GRCm39) S9P possibly damaging Het
Snrnp35 A C 5: 124,628,764 (GRCm39) R192S possibly damaging Het
Tlnrd1 A G 7: 83,531,805 (GRCm39) F209L probably benign Het
Tmprss12 C T 15: 100,183,149 (GRCm39) R164C probably damaging Het
Tnfsf4 T A 1: 161,244,644 (GRCm39) F111Y possibly damaging Het
Trib2 A T 12: 15,843,640 (GRCm39) M198K probably benign Het
Ttll8 A G 15: 88,798,507 (GRCm39) S743P possibly damaging Het
Ush2a A T 1: 188,460,580 (GRCm39) N2614Y probably benign Het
Usp6nl G A 2: 6,435,269 (GRCm39) V343I possibly damaging Het
Vrtn C A 12: 84,697,016 (GRCm39) Q589K probably benign Het
Zbed5 T A 5: 129,932,170 (GRCm39) Y706* probably null Het
Zc3h10 A G 10: 128,380,553 (GRCm39) V268A probably damaging Het
Zfp442 C T 2: 150,252,860 (GRCm39) probably null Het
Zpld2 A T 4: 133,920,464 (GRCm39) M567K probably benign Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99,259,583 (GRCm39) missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCCCCGAATACTTTCAATG -3'
(R):5'- AGAAGGCATTATAGGAGCTCTGC -3'

Sequencing Primer
(F):5'- CCGAATACTTTCAATGTGGGC -3'
(R):5'- AGCTCTGCTGCATGTGGC -3'
Posted On 2018-11-06