Incidental Mutation 'R6931:Rbm33'
ID540011
Institutional Source Beutler Lab
Gene Symbol Rbm33
Ensembl Gene ENSMUSG00000048271
Gene NameRNA binding motif protein 33
Synonyms6430512A10Rik, 3200001K10Rik, Prr8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6931 (G1)
Quality Score92.0077
Status Validated
Chromosome5
Chromosomal Location28317121-28419239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28410745 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 29 (V29M)
Ref Sequence ENSEMBL: ENSMUSP00000122901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059644] [ENSMUST00000114884] [ENSMUST00000133313]
Predicted Effect unknown
Transcript: ENSMUST00000059644
AA Change: V1182M
SMART Domains Protein: ENSMUSP00000062449
Gene: ENSMUSG00000048271
AA Change: V1182M

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 307 327 N/A INTRINSIC
low complexity region 362 407 N/A INTRINSIC
low complexity region 444 460 N/A INTRINSIC
low complexity region 625 707 N/A INTRINSIC
low complexity region 817 837 N/A INTRINSIC
coiled coil region 846 891 N/A INTRINSIC
RRM 1160 1227 1.12e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114884
AA Change: V1142M
SMART Domains Protein: ENSMUSP00000110534
Gene: ENSMUSG00000048271
AA Change: V1142M

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 36 55 N/A INTRINSIC
low complexity region 59 81 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
low complexity region 267 287 N/A INTRINSIC
low complexity region 322 367 N/A INTRINSIC
low complexity region 404 420 N/A INTRINSIC
low complexity region 585 667 N/A INTRINSIC
low complexity region 777 797 N/A INTRINSIC
coiled coil region 806 851 N/A INTRINSIC
RRM 1120 1187 4.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133313
AA Change: V29M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122901
Gene: ENSMUSG00000048271
AA Change: V29M

DomainStartEndE-ValueType
Pfam:RRM_1 8 65 3.2e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000144967
AA Change: V333M
SMART Domains Protein: ENSMUSP00000121879
Gene: ENSMUSG00000048271
AA Change: V333M

DomainStartEndE-ValueType
RRM 119 186 1.12e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,548 T172A possibly damaging Het
2310003L06Rik T A 5: 87,970,702 I15N probably damaging Het
2900092C05Rik T A 7: 12,512,596 S6R unknown Het
Abca6 T A 11: 110,244,328 L210F probably benign Het
Abcc4 T C 14: 118,527,988 Q919R probably damaging Het
Adcy1 A G 11: 7,150,884 D811G possibly damaging Het
Akna A G 4: 63,387,102 S476P probably benign Het
Ankrd49 T C 9: 14,782,826 N15S probably benign Het
Apcdd1 A G 18: 62,933,908 D31G probably damaging Het
Aplp1 G T 7: 30,443,200 R106S probably damaging Het
Arhgap40 T C 2: 158,531,218 L132S probably benign Het
Atp8b5 G T 4: 43,364,108 probably null Het
Axl T C 7: 25,761,433 D717G probably damaging Het
Bub1 T A 2: 127,801,382 D1014V probably damaging Het
Cacna2d4 T A 6: 119,282,234 V603E possibly damaging Het
Cnot11 G C 1: 39,539,921 C289S probably damaging Het
Coasy A G 11: 101,083,581 H191R probably benign Het
Cyp11a1 A T 9: 58,025,120 N341Y possibly damaging Het
Cyp1a2 T C 9: 57,682,156 N125S probably benign Het
Cyp2j8 A T 4: 96,444,781 probably null Het
Dnah9 A T 11: 66,117,626 I791K possibly damaging Het
Ecm2 A T 13: 49,529,011 Q505H probably benign Het
Fam135a T A 1: 24,085,487 M1L probably damaging Het
Fam171a2 A G 11: 102,438,434 S500P possibly damaging Het
Fat3 A G 9: 15,959,942 S3718P possibly damaging Het
Frem1 G A 4: 82,970,677 P1085S probably damaging Het
Gcfc2 A G 6: 81,942,985 I390V probably benign Het
Gemin4 A G 11: 76,210,956 L993P probably damaging Het
Ggnbp2 T A 11: 84,833,167 D647V probably damaging Het
Gm7534 A T 4: 134,193,153 M567K probably benign Het
Gpr84 A C 15: 103,309,014 L212R probably damaging Het
Hnrnpu T C 1: 178,331,432 probably benign Het
Hspg2 G T 4: 137,540,720 C2116F probably damaging Het
Icam4 T A 9: 21,030,451 V249E probably damaging Het
Itga1 T C 13: 115,001,563 N429D probably benign Het
Kcns1 T C 2: 164,164,838 T402A probably damaging Het
Ky T A 9: 102,537,627 V246E probably damaging Het
March1 A G 8: 66,468,492 T529A probably benign Het
Med18 C G 4: 132,459,883 V102L probably damaging Het
Mlst8 T C 17: 24,477,275 D160G probably damaging Het
Mthfd1 T C 12: 76,303,698 I470T probably benign Het
Muc1 C T 3: 89,229,159 probably benign Het
Mup8 G A 4: 60,220,322 L137F probably damaging Het
Mybpc1 A T 10: 88,542,330 L341* probably null Het
Nacad A G 11: 6,601,877 F438S probably benign Het
Necap2 C A 4: 141,078,212 probably null Het
Nifk T C 1: 118,332,348 L163S possibly damaging Het
Npsr1 A G 9: 24,289,997 I73V probably benign Het
Olfr1179 G A 2: 88,402,064 T290I probably benign Het
Olfr1186 T A 2: 88,526,194 C204S possibly damaging Het
Olfr142 A T 2: 90,252,777 C70* probably null Het
Olfr715 A G 7: 107,128,901 L164P probably damaging Het
Oog3 C T 4: 144,159,353 C225Y probably benign Het
Plagl2 C A 2: 153,235,943 K39N probably benign Het
Plcg2 T A 8: 117,557,319 D118E probably benign Het
Ppp4r3b A T 11: 29,211,786 K720I possibly damaging Het
Prmt3 A T 7: 49,829,016 T442S probably benign Het
Prr14l G A 5: 32,830,691 H487Y probably damaging Het
Psmb3 G A 11: 97,703,971 V63I probably benign Het
Psmc6 T A 14: 45,343,725 I326K possibly damaging Het
Ptcd1 T C 5: 145,155,075 T405A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scarb1 T A 5: 125,284,719 I107F probably damaging Het
Slc39a12 A G 2: 14,389,375 S19G probably benign Het
Slc44a5 T C 3: 154,258,506 V503A probably benign Het
Slc9a9 T C 9: 94,670,086 S9P possibly damaging Het
Snrnp35 A C 5: 124,490,701 R192S possibly damaging Het
Tbx15 T C 3: 99,352,151 L446P probably damaging Het
Tlnrd1 A G 7: 83,882,597 F209L probably benign Het
Tmprss12 C T 15: 100,285,268 R164C probably damaging Het
Tnfsf4 T A 1: 161,417,073 F111Y possibly damaging Het
Trib2 A T 12: 15,793,639 M198K probably benign Het
Ttll8 A G 15: 88,914,304 S743P possibly damaging Het
Ush2a A T 1: 188,728,383 N2614Y probably benign Het
Usp6nl G A 2: 6,430,458 V343I possibly damaging Het
Vrtn C A 12: 84,650,242 Q589K probably benign Het
Zbed5 T A 5: 129,903,329 Y706* probably null Het
Zc3h10 A G 10: 128,544,684 V268A probably damaging Het
Zfp442 C T 2: 150,410,940 probably null Het
Other mutations in Rbm33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Rbm33 APN 5 28410709 missense probably damaging 0.98
IGL01470:Rbm33 APN 5 28387848 missense probably damaging 1.00
IGL01565:Rbm33 APN 5 28391079 unclassified probably benign
IGL02119:Rbm33 APN 5 28339017 missense probably damaging 1.00
IGL02740:Rbm33 APN 5 28331123 missense probably damaging 1.00
IGL02869:Rbm33 APN 5 28410755 missense probably damaging 0.99
IGL03355:Rbm33 APN 5 28391061 unclassified probably benign
IGL03381:Rbm33 APN 5 28394392 missense unknown
FR4449:Rbm33 UTSW 5 28394168 small deletion probably benign
FR4548:Rbm33 UTSW 5 28394201 small deletion probably benign
R0091:Rbm33 UTSW 5 28352606 missense possibly damaging 0.94
R0725:Rbm33 UTSW 5 28394483 missense unknown
R1522:Rbm33 UTSW 5 28337004 missense probably damaging 1.00
R1918:Rbm33 UTSW 5 28387917 missense probably damaging 1.00
R2186:Rbm33 UTSW 5 28394230 missense unknown
R2448:Rbm33 UTSW 5 28342417 missense probably benign 0.01
R4151:Rbm33 UTSW 5 28387940 missense probably damaging 1.00
R4685:Rbm33 UTSW 5 28408282 unclassified probably benign
R4787:Rbm33 UTSW 5 28342437 splice site probably null
R4954:Rbm33 UTSW 5 28339276 missense probably damaging 1.00
R5013:Rbm33 UTSW 5 28342411 missense probably benign 0.05
R5141:Rbm33 UTSW 5 28352689 missense probably damaging 1.00
R5248:Rbm33 UTSW 5 28337052 critical splice donor site probably null
R5259:Rbm33 UTSW 5 28352774 splice site probably null
R5695:Rbm33 UTSW 5 28339012 missense probably damaging 1.00
R5790:Rbm33 UTSW 5 28339298 missense probably damaging 1.00
R6591:Rbm33 UTSW 5 28352546 missense probably damaging 0.99
R6668:Rbm33 UTSW 5 28342500 missense probably benign 0.01
R6691:Rbm33 UTSW 5 28352546 missense probably damaging 0.99
R6930:Rbm33 UTSW 5 28352506 missense probably benign 0.09
R7034:Rbm33 UTSW 5 28394498 missense unknown
R7056:Rbm33 UTSW 5 28394003 unclassified probably benign
R7224:Rbm33 UTSW 5 28394324 missense
R7579:Rbm33 UTSW 5 28368266 missense probably damaging 1.00
R7839:Rbm33 UTSW 5 28368399 splice site probably null
R7961:Rbm33 UTSW 5 28394608 missense
R8009:Rbm33 UTSW 5 28394608 missense
R8051:Rbm33 UTSW 5 28352625 missense probably damaging 0.99
R8265:Rbm33 UTSW 5 28394324 missense
RF011:Rbm33 UTSW 5 28394181 small deletion probably benign
RF026:Rbm33 UTSW 5 28394181 small deletion probably benign
RF047:Rbm33 UTSW 5 28394162 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTCATTGCCAGGCCATCATG -3'
(R):5'- TAGGTGCCTGTACACATGTG -3'

Sequencing Primer
(F):5'- CATCATGCATGGACGAGGAC -3'
(R):5'- CCTGTACACATGTGAACTGTAGGAC -3'
Posted On2018-11-06