Incidental Mutation 'R6931:Cacna2d4'
ID540020
Institutional Source Beutler Lab
Gene Symbol Cacna2d4
Ensembl Gene ENSMUSG00000041460
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 4
Synonyms5730412N02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6931 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location119236526-119352407 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119282234 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 603 (V603E)
Ref Sequence ENSEMBL: ENSMUSP00000140197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037434] [ENSMUST00000186622]
Predicted Effect probably benign
Transcript: ENSMUST00000037434
AA Change: V628E

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044660
Gene: ENSMUSG00000041460
AA Change: V628E

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 7.3e-40 PFAM
VWA 296 481 4.37e-14 SMART
Pfam:Cache_1 494 586 1.1e-24 PFAM
low complexity region 837 849 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1000 1011 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186622
AA Change: V603E

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140197
Gene: ENSMUSG00000041460
AA Change: V603E

DomainStartEndE-ValueType
Blast:WNT1 79 144 1e-13 BLAST
Pfam:VWA_N 155 271 6.4e-44 PFAM
VWA 296 481 2.7e-16 SMART
Pfam:Cache_1 494 559 1.1e-7 PFAM
low complexity region 812 824 N/A INTRINSIC
low complexity region 950 959 N/A INTRINSIC
low complexity region 975 986 N/A INTRINSIC
low complexity region 1095 1118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha-2/delta subunit family, a protein in the voltage-dependent calcium channel complex. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. Research on a highly similar protein in rabbit suggests the protein described in this record is cleaved into alpha-2 and delta subunits. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit severe loss of retinal signaling associated with abnormal photoreceptor ribbon synapses and cone-rod dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,548 T172A possibly damaging Het
2310003L06Rik T A 5: 87,970,702 I15N probably damaging Het
2900092C05Rik T A 7: 12,512,596 S6R unknown Het
Abca6 T A 11: 110,244,328 L210F probably benign Het
Abcc4 T C 14: 118,527,988 Q919R probably damaging Het
Adcy1 A G 11: 7,150,884 D811G possibly damaging Het
Akna A G 4: 63,387,102 S476P probably benign Het
Ankrd49 T C 9: 14,782,826 N15S probably benign Het
Apcdd1 A G 18: 62,933,908 D31G probably damaging Het
Aplp1 G T 7: 30,443,200 R106S probably damaging Het
Arhgap40 T C 2: 158,531,218 L132S probably benign Het
Atp8b5 G T 4: 43,364,108 probably null Het
Axl T C 7: 25,761,433 D717G probably damaging Het
Bub1 T A 2: 127,801,382 D1014V probably damaging Het
Cnot11 G C 1: 39,539,921 C289S probably damaging Het
Coasy A G 11: 101,083,581 H191R probably benign Het
Cyp11a1 A T 9: 58,025,120 N341Y possibly damaging Het
Cyp1a2 T C 9: 57,682,156 N125S probably benign Het
Cyp2j8 A T 4: 96,444,781 probably null Het
Dnah9 A T 11: 66,117,626 I791K possibly damaging Het
Ecm2 A T 13: 49,529,011 Q505H probably benign Het
Fam135a T A 1: 24,085,487 M1L probably damaging Het
Fam171a2 A G 11: 102,438,434 S500P possibly damaging Het
Fat3 A G 9: 15,959,942 S3718P possibly damaging Het
Frem1 G A 4: 82,970,677 P1085S probably damaging Het
Gcfc2 A G 6: 81,942,985 I390V probably benign Het
Gemin4 A G 11: 76,210,956 L993P probably damaging Het
Ggnbp2 T A 11: 84,833,167 D647V probably damaging Het
Gm7534 A T 4: 134,193,153 M567K probably benign Het
Gpr84 A C 15: 103,309,014 L212R probably damaging Het
Hnrnpu T C 1: 178,331,432 probably benign Het
Hspg2 G T 4: 137,540,720 C2116F probably damaging Het
Icam4 T A 9: 21,030,451 V249E probably damaging Het
Itga1 T C 13: 115,001,563 N429D probably benign Het
Kcns1 T C 2: 164,164,838 T402A probably damaging Het
Ky T A 9: 102,537,627 V246E probably damaging Het
March1 A G 8: 66,468,492 T529A probably benign Het
Med18 C G 4: 132,459,883 V102L probably damaging Het
Mlst8 T C 17: 24,477,275 D160G probably damaging Het
Mthfd1 T C 12: 76,303,698 I470T probably benign Het
Muc1 C T 3: 89,229,159 probably benign Het
Mup8 G A 4: 60,220,322 L137F probably damaging Het
Mybpc1 A T 10: 88,542,330 L341* probably null Het
Nacad A G 11: 6,601,877 F438S probably benign Het
Necap2 C A 4: 141,078,212 probably null Het
Nifk T C 1: 118,332,348 L163S possibly damaging Het
Npsr1 A G 9: 24,289,997 I73V probably benign Het
Olfr1179 G A 2: 88,402,064 T290I probably benign Het
Olfr1186 T A 2: 88,526,194 C204S possibly damaging Het
Olfr142 A T 2: 90,252,777 C70* probably null Het
Olfr715 A G 7: 107,128,901 L164P probably damaging Het
Oog3 C T 4: 144,159,353 C225Y probably benign Het
Plagl2 C A 2: 153,235,943 K39N probably benign Het
Plcg2 T A 8: 117,557,319 D118E probably benign Het
Ppp4r3b A T 11: 29,211,786 K720I possibly damaging Het
Prmt3 A T 7: 49,829,016 T442S probably benign Het
Prr14l G A 5: 32,830,691 H487Y probably damaging Het
Psmb3 G A 11: 97,703,971 V63I probably benign Het
Psmc6 T A 14: 45,343,725 I326K possibly damaging Het
Ptcd1 T C 5: 145,155,075 T405A probably benign Het
Rbm33 G A 5: 28,410,745 V29M probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scarb1 T A 5: 125,284,719 I107F probably damaging Het
Slc39a12 A G 2: 14,389,375 S19G probably benign Het
Slc44a5 T C 3: 154,258,506 V503A probably benign Het
Slc9a9 T C 9: 94,670,086 S9P possibly damaging Het
Snrnp35 A C 5: 124,490,701 R192S possibly damaging Het
Tbx15 T C 3: 99,352,151 L446P probably damaging Het
Tlnrd1 A G 7: 83,882,597 F209L probably benign Het
Tmprss12 C T 15: 100,285,268 R164C probably damaging Het
Tnfsf4 T A 1: 161,417,073 F111Y possibly damaging Het
Trib2 A T 12: 15,793,639 M198K probably benign Het
Ttll8 A G 15: 88,914,304 S743P possibly damaging Het
Ush2a A T 1: 188,728,383 N2614Y probably benign Het
Usp6nl G A 2: 6,430,458 V343I possibly damaging Het
Vrtn C A 12: 84,650,242 Q589K probably benign Het
Zbed5 T A 5: 129,903,329 Y706* probably null Het
Zc3h10 A G 10: 128,544,684 V268A probably damaging Het
Zfp442 C T 2: 150,410,940 probably null Het
Other mutations in Cacna2d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Cacna2d4 APN 6 119337933 splice site probably benign
IGL00469:Cacna2d4 APN 6 119268278 missense probably damaging 1.00
IGL00518:Cacna2d4 APN 6 119343575 missense probably damaging 1.00
IGL00946:Cacna2d4 APN 6 119271915 missense possibly damaging 0.82
IGL01447:Cacna2d4 APN 6 119242904 missense probably damaging 1.00
IGL01514:Cacna2d4 APN 6 119282173 splice site probably benign
IGL01576:Cacna2d4 APN 6 119281641 nonsense probably null
IGL01934:Cacna2d4 APN 6 119308768 missense probably damaging 1.00
IGL02231:Cacna2d4 APN 6 119277908 splice site probably benign
IGL02516:Cacna2d4 APN 6 119271870 splice site probably benign
IGL02688:Cacna2d4 APN 6 119270749 splice site probably null
IGL03110:Cacna2d4 APN 6 119236737 missense probably benign 0.05
IGL03365:Cacna2d4 APN 6 119271264 missense probably benign 0.15
saccharine UTSW 6 119345106 splice site probably benign
Steveo UTSW 6 119347252 critical splice donor site probably null
Sussmann UTSW 6 119274318 missense probably damaging 1.00
R0139:Cacna2d4 UTSW 6 119278269 intron probably benign
R0157:Cacna2d4 UTSW 6 119312424 missense probably benign 0.00
R0158:Cacna2d4 UTSW 6 119236748 missense possibly damaging 0.68
R0245:Cacna2d4 UTSW 6 119308721 missense probably damaging 1.00
R0612:Cacna2d4 UTSW 6 119281718 splice site probably benign
R0659:Cacna2d4 UTSW 6 119345106 splice site probably benign
R0722:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0743:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0833:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0835:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0836:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R0884:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1052:Cacna2d4 UTSW 6 119300333 missense probably damaging 1.00
R1168:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1170:Cacna2d4 UTSW 6 119307286 missense probably damaging 1.00
R1451:Cacna2d4 UTSW 6 119236824 missense probably benign 0.01
R1564:Cacna2d4 UTSW 6 119241195 missense possibly damaging 0.67
R1809:Cacna2d4 UTSW 6 119270824 missense probably damaging 0.99
R1936:Cacna2d4 UTSW 6 119270761 missense possibly damaging 0.82
R2078:Cacna2d4 UTSW 6 119338116 missense probably benign 0.02
R2198:Cacna2d4 UTSW 6 119347259 splice site probably benign
R2280:Cacna2d4 UTSW 6 119350041 missense possibly damaging 0.85
R3757:Cacna2d4 UTSW 6 119241163 missense probably damaging 0.98
R3975:Cacna2d4 UTSW 6 119278173 intron probably null
R3976:Cacna2d4 UTSW 6 119278173 intron probably null
R4238:Cacna2d4 UTSW 6 119240708 missense probably null 1.00
R4591:Cacna2d4 UTSW 6 119298464 missense probably benign 0.02
R4856:Cacna2d4 UTSW 6 119278256 missense possibly damaging 0.90
R4899:Cacna2d4 UTSW 6 119268196 nonsense probably null
R5319:Cacna2d4 UTSW 6 119347252 critical splice donor site probably null
R5351:Cacna2d4 UTSW 6 119268201 missense probably damaging 1.00
R5366:Cacna2d4 UTSW 6 119274318 missense probably damaging 1.00
R5393:Cacna2d4 UTSW 6 119239054 missense probably benign 0.20
R5395:Cacna2d4 UTSW 6 119271418 missense possibly damaging 0.71
R5408:Cacna2d4 UTSW 6 119348791 missense probably damaging 1.00
R5603:Cacna2d4 UTSW 6 119244285 missense probably damaging 1.00
R5661:Cacna2d4 UTSW 6 119343531 missense probably benign
R5898:Cacna2d4 UTSW 6 119274231 missense probably damaging 1.00
R5928:Cacna2d4 UTSW 6 119281698 missense probably benign 0.06
R6186:Cacna2d4 UTSW 6 119281689 missense possibly damaging 0.94
R6218:Cacna2d4 UTSW 6 119239060 missense probably damaging 0.99
R6257:Cacna2d4 UTSW 6 119281619 critical splice acceptor site probably null
R6409:Cacna2d4 UTSW 6 119282228 missense probably damaging 0.99
R7221:Cacna2d4 UTSW 6 119236663 missense probably benign 0.02
R7363:Cacna2d4 UTSW 6 119343978 missense probably damaging 1.00
R7371:Cacna2d4 UTSW 6 119308709 missense probably benign 0.07
R7382:Cacna2d4 UTSW 6 119239087 missense probably damaging 1.00
R7431:Cacna2d4 UTSW 6 119244276 missense probably damaging 0.98
R7517:Cacna2d4 UTSW 6 119271921 missense probably benign 0.01
R7527:Cacna2d4 UTSW 6 119271247 missense probably benign 0.00
R7529:Cacna2d4 UTSW 6 119270766 missense probably benign 0.01
R7710:Cacna2d4 UTSW 6 119274239 missense probably benign 0.05
R7880:Cacna2d4 UTSW 6 119349155 missense probably damaging 0.99
R8007:Cacna2d4 UTSW 6 119312444 missense probably benign
R8084:Cacna2d4 UTSW 6 119300352 missense probably damaging 1.00
R8159:Cacna2d4 UTSW 6 119297527 missense probably benign 0.01
RF023:Cacna2d4 UTSW 6 119268230 missense probably benign 0.19
Z1176:Cacna2d4 UTSW 6 119312450 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AGTGAGAGCCCACAACTGTG -3'
(R):5'- AGAGCTGCCAATGATCTGGG -3'

Sequencing Primer
(F):5'- AGGTCCATCTTCCCTCCTAGAAG -3'
(R):5'- ACCTCCACACCCAGCGG -3'
Posted On2018-11-06