Incidental Mutation 'R6931:Cyp1a2'
ID 540033
Institutional Source Beutler Lab
Gene Symbol Cyp1a2
Ensembl Gene ENSMUSG00000032310
Gene Name cytochrome P450, family 1, subfamily a, polypeptide 2
Synonyms aromatic compound inducible, CP12, P450-3
MMRRC Submission 045326-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.245) question?
Stock # R6931 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 57584220-57590938 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57589439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 125 (N125S)
Ref Sequence ENSEMBL: ENSMUSP00000034860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034860]
AlphaFold P00186
Predicted Effect probably benign
Transcript: ENSMUST00000034860
AA Change: N125S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000034860
Gene: ENSMUSG00000032310
AA Change: N125S

DomainStartEndE-ValueType
Pfam:p450 41 504 1.7e-105 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. Other xenobiotic substrates for this enzyme include caffeine, aflatoxin B1, and acetaminophen. The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 88,118,561 (GRCm39) I15N probably damaging Het
2900092C05Rik T A 7: 12,246,523 (GRCm39) S6R unknown Het
Abca6 T A 11: 110,135,154 (GRCm39) L210F probably benign Het
Abcc4 T C 14: 118,765,400 (GRCm39) Q919R probably damaging Het
Adcy1 A G 11: 7,100,884 (GRCm39) D811G possibly damaging Het
Akna A G 4: 63,305,339 (GRCm39) S476P probably benign Het
Ankrd49 T C 9: 14,694,122 (GRCm39) N15S probably benign Het
Apcdd1 A G 18: 63,066,979 (GRCm39) D31G probably damaging Het
Aplp1 G T 7: 30,142,625 (GRCm39) R106S probably damaging Het
Arhgap40 T C 2: 158,373,138 (GRCm39) L132S probably benign Het
Atp8b5 G T 4: 43,364,108 (GRCm39) probably null Het
Axl T C 7: 25,460,858 (GRCm39) D717G probably damaging Het
Bub1 T A 2: 127,643,302 (GRCm39) D1014V probably damaging Het
Cacna2d4 T A 6: 119,259,195 (GRCm39) V603E possibly damaging Het
Cnot11 G C 1: 39,579,002 (GRCm39) C289S probably damaging Het
Coasy A G 11: 100,974,407 (GRCm39) H191R probably benign Het
Cyp11a1 A T 9: 57,932,403 (GRCm39) N341Y possibly damaging Het
Cyp2j8 A T 4: 96,333,018 (GRCm39) probably null Het
Dnah9 A T 11: 66,008,452 (GRCm39) I791K possibly damaging Het
Ecm2 A T 13: 49,682,487 (GRCm39) Q505H probably benign Het
Fam135a T A 1: 24,124,568 (GRCm39) M1L probably damaging Het
Fam171a2 A G 11: 102,329,260 (GRCm39) S500P possibly damaging Het
Fat3 A G 9: 15,871,238 (GRCm39) S3718P possibly damaging Het
Frem1 G A 4: 82,888,914 (GRCm39) P1085S probably damaging Het
Gcfc2 A G 6: 81,919,966 (GRCm39) I390V probably benign Het
Gemin4 A G 11: 76,101,782 (GRCm39) L993P probably damaging Het
Ggnbp2 T A 11: 84,723,993 (GRCm39) D647V probably damaging Het
Gpr84 A C 15: 103,217,441 (GRCm39) L212R probably damaging Het
Hnrnpu T C 1: 178,158,997 (GRCm39) probably benign Het
Hspg2 G T 4: 137,268,031 (GRCm39) C2116F probably damaging Het
Icam4 T A 9: 20,941,747 (GRCm39) V249E probably damaging Het
Itga1 T C 13: 115,138,099 (GRCm39) N429D probably benign Het
Kcns1 T C 2: 164,006,758 (GRCm39) T402A probably damaging Het
Ky T A 9: 102,414,826 (GRCm39) V246E probably damaging Het
Marchf1 A G 8: 66,921,144 (GRCm39) T529A probably benign Het
Med18 C G 4: 132,187,194 (GRCm39) V102L probably damaging Het
Mlst8 T C 17: 24,696,249 (GRCm39) D160G probably damaging Het
Mthfd1 T C 12: 76,350,472 (GRCm39) I470T probably benign Het
Muc1 C T 3: 89,136,466 (GRCm39) probably benign Het
Mup8 G A 4: 60,220,322 (GRCm39) L137F probably damaging Het
Mybpc1 A T 10: 88,378,192 (GRCm39) L341* probably null Het
Nacad A G 11: 6,551,877 (GRCm39) F438S probably benign Het
Necap2 C A 4: 140,805,523 (GRCm39) probably null Het
Nifk T C 1: 118,260,078 (GRCm39) L163S possibly damaging Het
Npsr1 A G 9: 24,201,293 (GRCm39) I73V probably benign Het
Nup50l T C 6: 96,142,529 (GRCm39) T172A possibly damaging Het
Oog3 C T 4: 143,885,923 (GRCm39) C225Y probably benign Het
Or2d2 A G 7: 106,728,108 (GRCm39) L164P probably damaging Het
Or4b13 A T 2: 90,083,121 (GRCm39) C70* probably null Het
Or4c100 T A 2: 88,356,538 (GRCm39) C204S possibly damaging Het
Or4p18 G A 2: 88,232,408 (GRCm39) T290I probably benign Het
Plagl2 C A 2: 153,077,863 (GRCm39) K39N probably benign Het
Plcg2 T A 8: 118,284,058 (GRCm39) D118E probably benign Het
Ppp4r3b A T 11: 29,161,786 (GRCm39) K720I possibly damaging Het
Prmt3 A T 7: 49,478,764 (GRCm39) T442S probably benign Het
Prr14l G A 5: 32,988,035 (GRCm39) H487Y probably damaging Het
Psmb3 G A 11: 97,594,797 (GRCm39) V63I probably benign Het
Psmc6 T A 14: 45,581,182 (GRCm39) I326K possibly damaging Het
Ptcd1 T C 5: 145,091,885 (GRCm39) T405A probably benign Het
Rbm33 G A 5: 28,615,743 (GRCm39) V29M probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Scarb1 T A 5: 125,361,783 (GRCm39) I107F probably damaging Het
Slc39a12 A G 2: 14,394,186 (GRCm39) S19G probably benign Het
Slc44a5 T C 3: 153,964,143 (GRCm39) V503A probably benign Het
Slc9a9 T C 9: 94,552,139 (GRCm39) S9P possibly damaging Het
Snrnp35 A C 5: 124,628,764 (GRCm39) R192S possibly damaging Het
Tbx15 T C 3: 99,259,467 (GRCm39) L446P probably damaging Het
Tlnrd1 A G 7: 83,531,805 (GRCm39) F209L probably benign Het
Tmprss12 C T 15: 100,183,149 (GRCm39) R164C probably damaging Het
Tnfsf4 T A 1: 161,244,644 (GRCm39) F111Y possibly damaging Het
Trib2 A T 12: 15,843,640 (GRCm39) M198K probably benign Het
Ttll8 A G 15: 88,798,507 (GRCm39) S743P possibly damaging Het
Ush2a A T 1: 188,460,580 (GRCm39) N2614Y probably benign Het
Usp6nl G A 2: 6,435,269 (GRCm39) V343I possibly damaging Het
Vrtn C A 12: 84,697,016 (GRCm39) Q589K probably benign Het
Zbed5 T A 5: 129,932,170 (GRCm39) Y706* probably null Het
Zc3h10 A G 10: 128,380,553 (GRCm39) V268A probably damaging Het
Zfp442 C T 2: 150,252,860 (GRCm39) probably null Het
Zpld2 A T 4: 133,920,464 (GRCm39) M567K probably benign Het
Other mutations in Cyp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp1a2 APN 9 57,589,352 (GRCm39) nonsense probably null
IGL01161:Cyp1a2 APN 9 57,587,176 (GRCm39) missense probably damaging 1.00
IGL01583:Cyp1a2 APN 9 57,589,655 (GRCm39) missense probably benign 0.31
IGL01726:Cyp1a2 APN 9 57,589,485 (GRCm39) missense possibly damaging 0.78
IGL01973:Cyp1a2 APN 9 57,589,678 (GRCm39) missense probably damaging 1.00
IGL02995:Cyp1a2 APN 9 57,584,511 (GRCm39) makesense probably null
IGL03349:Cyp1a2 APN 9 57,587,158 (GRCm39) missense possibly damaging 0.82
broadway UTSW 9 57,584,516 (GRCm39) nonsense probably null
PIT4515001:Cyp1a2 UTSW 9 57,589,242 (GRCm39) missense probably benign 0.14
R0025:Cyp1a2 UTSW 9 57,589,344 (GRCm39) missense probably damaging 1.00
R0389:Cyp1a2 UTSW 9 57,589,308 (GRCm39) missense probably benign 0.00
R0582:Cyp1a2 UTSW 9 57,587,529 (GRCm39) splice site probably benign
R0589:Cyp1a2 UTSW 9 57,586,345 (GRCm39) missense possibly damaging 0.95
R1239:Cyp1a2 UTSW 9 57,589,050 (GRCm39) missense probably benign 0.02
R1988:Cyp1a2 UTSW 9 57,589,569 (GRCm39) missense possibly damaging 0.90
R2156:Cyp1a2 UTSW 9 57,589,433 (GRCm39) missense probably damaging 1.00
R2173:Cyp1a2 UTSW 9 57,584,798 (GRCm39) missense probably damaging 1.00
R2423:Cyp1a2 UTSW 9 57,587,232 (GRCm39) missense probably damaging 0.99
R3944:Cyp1a2 UTSW 9 57,589,151 (GRCm39) missense probably benign
R5225:Cyp1a2 UTSW 9 57,584,516 (GRCm39) nonsense probably null
R5419:Cyp1a2 UTSW 9 57,589,794 (GRCm39) missense probably benign 0.17
R5471:Cyp1a2 UTSW 9 57,586,303 (GRCm39) missense probably damaging 0.96
R5816:Cyp1a2 UTSW 9 57,588,336 (GRCm39) missense probably benign
R6017:Cyp1a2 UTSW 9 57,588,313 (GRCm39) missense probably damaging 0.98
R6825:Cyp1a2 UTSW 9 57,584,543 (GRCm39) missense probably benign 0.01
R7058:Cyp1a2 UTSW 9 57,584,525 (GRCm39) missense probably damaging 0.99
R7079:Cyp1a2 UTSW 9 57,589,161 (GRCm39) missense probably benign
R7081:Cyp1a2 UTSW 9 57,586,272 (GRCm39) missense possibly damaging 0.52
R7400:Cyp1a2 UTSW 9 57,589,223 (GRCm39) missense probably benign 0.37
R7672:Cyp1a2 UTSW 9 57,589,620 (GRCm39) missense probably benign 0.05
R8097:Cyp1a2 UTSW 9 57,586,836 (GRCm39) splice site probably null
R8879:Cyp1a2 UTSW 9 57,589,168 (GRCm39) missense possibly damaging 0.55
R8926:Cyp1a2 UTSW 9 57,588,361 (GRCm39) missense probably benign 0.00
R9083:Cyp1a2 UTSW 9 57,587,572 (GRCm39) missense probably benign 0.01
R9206:Cyp1a2 UTSW 9 57,589,583 (GRCm39) missense probably damaging 1.00
R9208:Cyp1a2 UTSW 9 57,589,583 (GRCm39) missense probably damaging 1.00
R9784:Cyp1a2 UTSW 9 57,587,562 (GRCm39) missense probably benign 0.07
RF007:Cyp1a2 UTSW 9 57,589,253 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGAAGTGGCCAACCTCTG -3'
(R):5'- CATGCTGACTGTGGGGAAGAAC -3'

Sequencing Primer
(F):5'- AGTGGCCAACCTCTGCCATC -3'
(R):5'- TGTCACTGACACGGCTGAGTC -3'
Posted On 2018-11-06