Incidental Mutation 'R6931:Cyp11a1'
ID540034
Institutional Source Beutler Lab
Gene Symbol Cyp11a1
Ensembl Gene ENSMUSG00000032323
Gene Namecytochrome P450, family 11, subfamily a, polypeptide 1
SynonymsCyp11a, cholesterol side chain cleavage, Scc, cscc, D9Ertd411e, P450scc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6931 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location58006411-58027023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58025120 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 341 (N341Y)
Ref Sequence ENSEMBL: ENSMUSP00000034874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034874] [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000188116] [ENSMUST00000188539] [ENSMUST00000215944]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034874
AA Change: N341Y

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034874
Gene: ENSMUSG00000032323
AA Change: N341Y

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
Pfam:p450 49 507 1.8e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042205
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098682
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119665
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188116
SMART Domains Protein: ENSMUSP00000140545
Gene: ENSMUSG00000032323

DomainStartEndE-ValueType
Pfam:p450 32 115 3.5e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000188539
AA Change: N239Y

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140777
Gene: ENSMUSG00000032323
AA Change: N239Y

DomainStartEndE-ValueType
Pfam:p450 23 279 2.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215944
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and catalyzes the conversion of cholesterol to pregnenolone, the first and rate-limiting step in the synthesis of the steroid hormones. Two transcript variants encoding different isoforms have been found for this gene. The cellular location of the smaller isoform is unclear since it lacks the mitochondrial-targeting transit peptide. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are exhibit a steroid deficiency and die within days of birth showing signs of dehydration. Males are feminized with female external genitalia and underdeveloped gonads. Mice homozgyous for another knock-out allele exhibit abnormal adrenal development and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,548 T172A possibly damaging Het
2310003L06Rik T A 5: 87,970,702 I15N probably damaging Het
2900092C05Rik T A 7: 12,512,596 S6R unknown Het
Abca6 T A 11: 110,244,328 L210F probably benign Het
Abcc4 T C 14: 118,527,988 Q919R probably damaging Het
Adcy1 A G 11: 7,150,884 D811G possibly damaging Het
Akna A G 4: 63,387,102 S476P probably benign Het
Ankrd49 T C 9: 14,782,826 N15S probably benign Het
Apcdd1 A G 18: 62,933,908 D31G probably damaging Het
Aplp1 G T 7: 30,443,200 R106S probably damaging Het
Arhgap40 T C 2: 158,531,218 L132S probably benign Het
Atp8b5 G T 4: 43,364,108 probably null Het
Axl T C 7: 25,761,433 D717G probably damaging Het
Bub1 T A 2: 127,801,382 D1014V probably damaging Het
Cacna2d4 T A 6: 119,282,234 V603E possibly damaging Het
Cnot11 G C 1: 39,539,921 C289S probably damaging Het
Coasy A G 11: 101,083,581 H191R probably benign Het
Cyp1a2 T C 9: 57,682,156 N125S probably benign Het
Cyp2j8 A T 4: 96,444,781 probably null Het
Dnah9 A T 11: 66,117,626 I791K possibly damaging Het
Ecm2 A T 13: 49,529,011 Q505H probably benign Het
Fam135a T A 1: 24,085,487 M1L probably damaging Het
Fam171a2 A G 11: 102,438,434 S500P possibly damaging Het
Fat3 A G 9: 15,959,942 S3718P possibly damaging Het
Frem1 G A 4: 82,970,677 P1085S probably damaging Het
Gcfc2 A G 6: 81,942,985 I390V probably benign Het
Gemin4 A G 11: 76,210,956 L993P probably damaging Het
Ggnbp2 T A 11: 84,833,167 D647V probably damaging Het
Gm7534 A T 4: 134,193,153 M567K probably benign Het
Gpr84 A C 15: 103,309,014 L212R probably damaging Het
Hnrnpu T C 1: 178,331,432 probably benign Het
Hspg2 G T 4: 137,540,720 C2116F probably damaging Het
Icam4 T A 9: 21,030,451 V249E probably damaging Het
Itga1 T C 13: 115,001,563 N429D probably benign Het
Kcns1 T C 2: 164,164,838 T402A probably damaging Het
Ky T A 9: 102,537,627 V246E probably damaging Het
March1 A G 8: 66,468,492 T529A probably benign Het
Med18 C G 4: 132,459,883 V102L probably damaging Het
Mlst8 T C 17: 24,477,275 D160G probably damaging Het
Mthfd1 T C 12: 76,303,698 I470T probably benign Het
Muc1 C T 3: 89,229,159 probably benign Het
Mup8 G A 4: 60,220,322 L137F probably damaging Het
Mybpc1 A T 10: 88,542,330 L341* probably null Het
Nacad A G 11: 6,601,877 F438S probably benign Het
Necap2 C A 4: 141,078,212 probably null Het
Nifk T C 1: 118,332,348 L163S possibly damaging Het
Npsr1 A G 9: 24,289,997 I73V probably benign Het
Olfr1179 G A 2: 88,402,064 T290I probably benign Het
Olfr1186 T A 2: 88,526,194 C204S possibly damaging Het
Olfr142 A T 2: 90,252,777 C70* probably null Het
Olfr715 A G 7: 107,128,901 L164P probably damaging Het
Oog3 C T 4: 144,159,353 C225Y probably benign Het
Plagl2 C A 2: 153,235,943 K39N probably benign Het
Plcg2 T A 8: 117,557,319 D118E probably benign Het
Ppp4r3b A T 11: 29,211,786 K720I possibly damaging Het
Prmt3 A T 7: 49,829,016 T442S probably benign Het
Prr14l G A 5: 32,830,691 H487Y probably damaging Het
Psmb3 G A 11: 97,703,971 V63I probably benign Het
Psmc6 T A 14: 45,343,725 I326K possibly damaging Het
Ptcd1 T C 5: 145,155,075 T405A probably benign Het
Rbm33 G A 5: 28,410,745 V29M probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scarb1 T A 5: 125,284,719 I107F probably damaging Het
Slc39a12 A G 2: 14,389,375 S19G probably benign Het
Slc44a5 T C 3: 154,258,506 V503A probably benign Het
Slc9a9 T C 9: 94,670,086 S9P possibly damaging Het
Snrnp35 A C 5: 124,490,701 R192S possibly damaging Het
Tbx15 T C 3: 99,352,151 L446P probably damaging Het
Tlnrd1 A G 7: 83,882,597 F209L probably benign Het
Tmprss12 C T 15: 100,285,268 R164C probably damaging Het
Tnfsf4 T A 1: 161,417,073 F111Y possibly damaging Het
Trib2 A T 12: 15,793,639 M198K probably benign Het
Ttll8 A G 15: 88,914,304 S743P possibly damaging Het
Ush2a A T 1: 188,728,383 N2614Y probably benign Het
Usp6nl G A 2: 6,430,458 V343I possibly damaging Het
Vrtn C A 12: 84,650,242 Q589K probably benign Het
Zbed5 T A 5: 129,903,329 Y706* probably null Het
Zc3h10 A G 10: 128,544,684 V268A probably damaging Het
Zfp442 C T 2: 150,410,940 probably null Het
Other mutations in Cyp11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Cyp11a1 APN 9 58019313 missense probably damaging 1.00
IGL01122:Cyp11a1 APN 9 58016306 missense probably damaging 1.00
IGL01993:Cyp11a1 APN 9 58020823 missense probably damaging 1.00
PIT4431001:Cyp11a1 UTSW 9 58016272 critical splice acceptor site probably null
R0347:Cyp11a1 UTSW 9 58016260 unclassified probably benign
R1446:Cyp11a1 UTSW 9 58015277 missense possibly damaging 0.95
R1774:Cyp11a1 UTSW 9 58018360 missense probably benign 0.05
R1918:Cyp11a1 UTSW 9 58026757 missense probably damaging 1.00
R2935:Cyp11a1 UTSW 9 58016390 missense probably damaging 1.00
R3724:Cyp11a1 UTSW 9 58019322 missense probably benign 0.00
R4866:Cyp11a1 UTSW 9 58026097 missense probably damaging 1.00
R5301:Cyp11a1 UTSW 9 58019261 intron probably benign
R5718:Cyp11a1 UTSW 9 58018225 missense probably benign 0.00
R5787:Cyp11a1 UTSW 9 58015267 missense probably benign 0.03
R5988:Cyp11a1 UTSW 9 58020834 missense probably benign 0.01
R6044:Cyp11a1 UTSW 9 58026704 missense probably damaging 1.00
R6286:Cyp11a1 UTSW 9 58017418 intron probably benign
R6306:Cyp11a1 UTSW 9 58025100 missense probably benign 0.00
R6325:Cyp11a1 UTSW 9 58025568 missense probably benign
R6826:Cyp11a1 UTSW 9 58025087 missense probably damaging 0.97
R6960:Cyp11a1 UTSW 9 58018376 missense probably damaging 1.00
R7900:Cyp11a1 UTSW 9 58016384 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AATATCCCTTCCTAGGCATTAGC -3'
(R):5'- ATTAGCCCATCCTTGGAACCC -3'

Sequencing Primer
(F):5'- CATACTCAACATATATGGTGCCGGG -3'
(R):5'- ATCCTTGGAACCCTCTCCAGG -3'
Posted On2018-11-06