Incidental Mutation 'R6931:Ppp4r3b'
ID 540041
Institutional Source Beutler Lab
Gene Symbol Ppp4r3b
Ensembl Gene ENSMUSG00000020463
Gene Name protein phosphatase 4 regulatory subunit 3B
Synonyms Smek2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6931 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 29172890-29220797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 29211786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Isoleucine at position 720 (K720I)
Ref Sequence ENSEMBL: ENSMUSP00000020755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020755] [ENSMUST00000102856] [ENSMUST00000127621]
AlphaFold Q922R5
Predicted Effect possibly damaging
Transcript: ENSMUST00000020755
AA Change: K720I

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020755
Gene: ENSMUSG00000020463
AA Change: K720I

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 2e-24 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:SMK-1 168 359 3.6e-84 PFAM
low complexity region 511 519 N/A INTRINSIC
low complexity region 800 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102856
SMART Domains Protein: ENSMUSP00000099920
Gene: ENSMUSG00000020463

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 2e-25 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:SMK-1 166 359 3.8e-87 PFAM
low complexity region 511 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127621
SMART Domains Protein: ENSMUSP00000117918
Gene: ENSMUSG00000020463

DomainStartEndE-ValueType
low complexity region 90 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148759
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,548 T172A possibly damaging Het
2310003L06Rik T A 5: 87,970,702 I15N probably damaging Het
2900092C05Rik T A 7: 12,512,596 S6R unknown Het
Abca6 T A 11: 110,244,328 L210F probably benign Het
Abcc4 T C 14: 118,527,988 Q919R probably damaging Het
Adcy1 A G 11: 7,150,884 D811G possibly damaging Het
Akna A G 4: 63,387,102 S476P probably benign Het
Ankrd49 T C 9: 14,782,826 N15S probably benign Het
Apcdd1 A G 18: 62,933,908 D31G probably damaging Het
Aplp1 G T 7: 30,443,200 R106S probably damaging Het
Arhgap40 T C 2: 158,531,218 L132S probably benign Het
Atp8b5 G T 4: 43,364,108 probably null Het
Axl T C 7: 25,761,433 D717G probably damaging Het
Bub1 T A 2: 127,801,382 D1014V probably damaging Het
Cacna2d4 T A 6: 119,282,234 V603E possibly damaging Het
Cnot11 G C 1: 39,539,921 C289S probably damaging Het
Coasy A G 11: 101,083,581 H191R probably benign Het
Cyp11a1 A T 9: 58,025,120 N341Y possibly damaging Het
Cyp1a2 T C 9: 57,682,156 N125S probably benign Het
Cyp2j8 A T 4: 96,444,781 probably null Het
Dnah9 A T 11: 66,117,626 I791K possibly damaging Het
Ecm2 A T 13: 49,529,011 Q505H probably benign Het
Fam135a T A 1: 24,085,487 M1L probably damaging Het
Fam171a2 A G 11: 102,438,434 S500P possibly damaging Het
Fat3 A G 9: 15,959,942 S3718P possibly damaging Het
Frem1 G A 4: 82,970,677 P1085S probably damaging Het
Gcfc2 A G 6: 81,942,985 I390V probably benign Het
Gemin4 A G 11: 76,210,956 L993P probably damaging Het
Ggnbp2 T A 11: 84,833,167 D647V probably damaging Het
Gm7534 A T 4: 134,193,153 M567K probably benign Het
Gpr84 A C 15: 103,309,014 L212R probably damaging Het
Hnrnpu T C 1: 178,331,432 probably benign Het
Hspg2 G T 4: 137,540,720 C2116F probably damaging Het
Icam4 T A 9: 21,030,451 V249E probably damaging Het
Itga1 T C 13: 115,001,563 N429D probably benign Het
Kcns1 T C 2: 164,164,838 T402A probably damaging Het
Ky T A 9: 102,537,627 V246E probably damaging Het
March1 A G 8: 66,468,492 T529A probably benign Het
Med18 C G 4: 132,459,883 V102L probably damaging Het
Mlst8 T C 17: 24,477,275 D160G probably damaging Het
Mthfd1 T C 12: 76,303,698 I470T probably benign Het
Muc1 C T 3: 89,229,159 probably benign Het
Mup8 G A 4: 60,220,322 L137F probably damaging Het
Mybpc1 A T 10: 88,542,330 L341* probably null Het
Nacad A G 11: 6,601,877 F438S probably benign Het
Necap2 C A 4: 141,078,212 probably null Het
Nifk T C 1: 118,332,348 L163S possibly damaging Het
Npsr1 A G 9: 24,289,997 I73V probably benign Het
Olfr1179 G A 2: 88,402,064 T290I probably benign Het
Olfr1186 T A 2: 88,526,194 C204S possibly damaging Het
Olfr142 A T 2: 90,252,777 C70* probably null Het
Olfr715 A G 7: 107,128,901 L164P probably damaging Het
Oog3 C T 4: 144,159,353 C225Y probably benign Het
Plagl2 C A 2: 153,235,943 K39N probably benign Het
Plcg2 T A 8: 117,557,319 D118E probably benign Het
Prmt3 A T 7: 49,829,016 T442S probably benign Het
Prr14l G A 5: 32,830,691 H487Y probably damaging Het
Psmb3 G A 11: 97,703,971 V63I probably benign Het
Psmc6 T A 14: 45,343,725 I326K possibly damaging Het
Ptcd1 T C 5: 145,155,075 T405A probably benign Het
Rbm33 G A 5: 28,410,745 V29M probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scarb1 T A 5: 125,284,719 I107F probably damaging Het
Slc39a12 A G 2: 14,389,375 S19G probably benign Het
Slc44a5 T C 3: 154,258,506 V503A probably benign Het
Slc9a9 T C 9: 94,670,086 S9P possibly damaging Het
Snrnp35 A C 5: 124,490,701 R192S possibly damaging Het
Tbx15 T C 3: 99,352,151 L446P probably damaging Het
Tlnrd1 A G 7: 83,882,597 F209L probably benign Het
Tmprss12 C T 15: 100,285,268 R164C probably damaging Het
Tnfsf4 T A 1: 161,417,073 F111Y possibly damaging Het
Trib2 A T 12: 15,793,639 M198K probably benign Het
Ttll8 A G 15: 88,914,304 S743P possibly damaging Het
Ush2a A T 1: 188,728,383 N2614Y probably benign Het
Usp6nl G A 2: 6,430,458 V343I possibly damaging Het
Vrtn C A 12: 84,650,242 Q589K probably benign Het
Zbed5 T A 5: 129,903,329 Y706* probably null Het
Zc3h10 A G 10: 128,544,684 V268A probably damaging Het
Zfp442 C T 2: 150,410,940 probably null Het
Other mutations in Ppp4r3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Ppp4r3b APN 11 29211782 missense possibly damaging 0.64
IGL00593:Ppp4r3b APN 11 29197205 missense possibly damaging 0.88
IGL01109:Ppp4r3b APN 11 29188288 missense probably damaging 0.97
IGL01311:Ppp4r3b APN 11 29194591 missense probably benign
IGL01397:Ppp4r3b APN 11 29213594 missense probably benign 0.05
IGL01546:Ppp4r3b APN 11 29209488 splice site probably null
IGL02588:Ppp4r3b APN 11 29198853 nonsense probably null
IGL02713:Ppp4r3b APN 11 29188445 missense probably damaging 0.98
IGL02717:Ppp4r3b APN 11 29173315 missense probably benign 0.01
brando UTSW 11 29211667 missense probably benign
Debatable UTSW 11 29209436 missense possibly damaging 0.86
Kindness UTSW 11 29173449 critical splice donor site probably null
Maris UTSW 11 29209356 missense probably damaging 1.00
Stella UTSW 11 29196290 missense probably null
PIT1430001:Ppp4r3b UTSW 11 29209434 missense probably benign 0.04
PIT4677001:Ppp4r3b UTSW 11 29187978 missense probably benign
R0766:Ppp4r3b UTSW 11 29173358 missense probably benign 0.16
R1170:Ppp4r3b UTSW 11 29209426 missense probably damaging 0.99
R1312:Ppp4r3b UTSW 11 29173358 missense probably benign 0.16
R1511:Ppp4r3b UTSW 11 29182460 missense probably damaging 1.00
R1692:Ppp4r3b UTSW 11 29188123 missense probably benign 0.02
R1699:Ppp4r3b UTSW 11 29213765 missense possibly damaging 0.52
R2303:Ppp4r3b UTSW 11 29200741 missense possibly damaging 0.79
R2339:Ppp4r3b UTSW 11 29200725 missense possibly damaging 0.65
R4378:Ppp4r3b UTSW 11 29209450 missense possibly damaging 0.72
R4940:Ppp4r3b UTSW 11 29211740 missense probably benign
R5256:Ppp4r3b UTSW 11 29188293 missense probably benign 0.22
R5266:Ppp4r3b UTSW 11 29173309 missense possibly damaging 0.63
R5286:Ppp4r3b UTSW 11 29211667 missense probably benign
R5354:Ppp4r3b UTSW 11 29211646 missense probably benign 0.26
R5877:Ppp4r3b UTSW 11 29209356 missense probably damaging 1.00
R6364:Ppp4r3b UTSW 11 29188035 missense probably benign 0.00
R6539:Ppp4r3b UTSW 11 29218503 missense probably benign 0.00
R6773:Ppp4r3b UTSW 11 29205639 missense probably benign 0.02
R7051:Ppp4r3b UTSW 11 29182507 missense probably damaging 1.00
R7176:Ppp4r3b UTSW 11 29198904 missense probably damaging 1.00
R7569:Ppp4r3b UTSW 11 29188540 missense possibly damaging 0.91
R7741:Ppp4r3b UTSW 11 29205701 missense possibly damaging 0.78
R7746:Ppp4r3b UTSW 11 29173352 missense probably benign 0.00
R7810:Ppp4r3b UTSW 11 29188086 missense probably benign 0.02
R8129:Ppp4r3b UTSW 11 29209364 missense probably damaging 1.00
R8680:Ppp4r3b UTSW 11 29173449 critical splice donor site probably null
R8685:Ppp4r3b UTSW 11 29209436 missense possibly damaging 0.86
R8910:Ppp4r3b UTSW 11 29196290 missense probably null
R8928:Ppp4r3b UTSW 11 29194598 missense probably benign 0.00
R8947:Ppp4r3b UTSW 11 29200758 missense possibly damaging 0.63
R8954:Ppp4r3b UTSW 11 29205669 missense possibly damaging 0.64
R8991:Ppp4r3b UTSW 11 29173306 start codon destroyed probably damaging 1.00
R9068:Ppp4r3b UTSW 11 29209396 missense probably benign 0.01
R9225:Ppp4r3b UTSW 11 29205648 missense possibly damaging 0.95
R9417:Ppp4r3b UTSW 11 29194598 missense probably benign 0.00
R9487:Ppp4r3b UTSW 11 29174697 missense probably damaging 1.00
R9635:Ppp4r3b UTSW 11 29188113 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCATCTATATTGCGTAGTAACCG -3'
(R):5'- GCCGGATCTGTTCAGAAGTATAG -3'

Sequencing Primer
(F):5'- GCGTAGTAACCGATTTCGCAG -3'
(R):5'- CAACGAGGCTATGTACTGTGACC -3'
Posted On 2018-11-06