Incidental Mutation 'R6931:Gemin4'
ID540043
Institutional Source Beutler Lab
Gene Symbol Gemin4
Ensembl Gene ENSMUSG00000049396
Gene Namegem nuclear organelle associated protein 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R6931 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location76210571-76217664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76210956 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 993 (L993P)
Ref Sequence ENSEMBL: ENSMUSP00000099558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094014] [ENSMUST00000102500] [ENSMUST00000129853] [ENSMUST00000169560] [ENSMUST00000169701]
Predicted Effect probably benign
Transcript: ENSMUST00000094014
SMART Domains Protein: ENSMUSP00000091553
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
TLC 33 249 7.47e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102500
AA Change: L993P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000129853
SMART Domains Protein: ENSMUSP00000114936
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
TLC 1 166 6.2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169560
SMART Domains Protein: ENSMUSP00000131151
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
TLC 33 217 4.92e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169701
SMART Domains Protein: ENSMUSP00000131174
Gene: ENSMUSG00000017286

DomainStartEndE-ValueType
Pfam:Glyoxalase_2 143 256 2.7e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is part of a large complex localized to the cytoplasm, nucleoli, and to discrete nuclear bodies called Gemini bodies (gems). The complex functions in spliceosomal snRNP assembly in the cytoplasm, and regenerates spliceosomes required for pre-mRNA splicing in the nucleus. The encoded protein directly interacts with a DEAD box protein and several spliceosome core proteins. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die before E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,548 T172A possibly damaging Het
2310003L06Rik T A 5: 87,970,702 I15N probably damaging Het
2900092C05Rik T A 7: 12,512,596 S6R unknown Het
Abca6 T A 11: 110,244,328 L210F probably benign Het
Abcc4 T C 14: 118,527,988 Q919R probably damaging Het
Adcy1 A G 11: 7,150,884 D811G possibly damaging Het
Akna A G 4: 63,387,102 S476P probably benign Het
Ankrd49 T C 9: 14,782,826 N15S probably benign Het
Apcdd1 A G 18: 62,933,908 D31G probably damaging Het
Aplp1 G T 7: 30,443,200 R106S probably damaging Het
Arhgap40 T C 2: 158,531,218 L132S probably benign Het
Atp8b5 G T 4: 43,364,108 probably null Het
Axl T C 7: 25,761,433 D717G probably damaging Het
Bub1 T A 2: 127,801,382 D1014V probably damaging Het
Cacna2d4 T A 6: 119,282,234 V603E possibly damaging Het
Cnot11 G C 1: 39,539,921 C289S probably damaging Het
Coasy A G 11: 101,083,581 H191R probably benign Het
Cyp11a1 A T 9: 58,025,120 N341Y possibly damaging Het
Cyp1a2 T C 9: 57,682,156 N125S probably benign Het
Cyp2j8 A T 4: 96,444,781 probably null Het
Dnah9 A T 11: 66,117,626 I791K possibly damaging Het
Ecm2 A T 13: 49,529,011 Q505H probably benign Het
Fam135a T A 1: 24,085,487 M1L probably damaging Het
Fam171a2 A G 11: 102,438,434 S500P possibly damaging Het
Fat3 A G 9: 15,959,942 S3718P possibly damaging Het
Frem1 G A 4: 82,970,677 P1085S probably damaging Het
Gcfc2 A G 6: 81,942,985 I390V probably benign Het
Ggnbp2 T A 11: 84,833,167 D647V probably damaging Het
Gm7534 A T 4: 134,193,153 M567K probably benign Het
Gpr84 A C 15: 103,309,014 L212R probably damaging Het
Hnrnpu T C 1: 178,331,432 probably benign Het
Hspg2 G T 4: 137,540,720 C2116F probably damaging Het
Icam4 T A 9: 21,030,451 V249E probably damaging Het
Itga1 T C 13: 115,001,563 N429D probably benign Het
Kcns1 T C 2: 164,164,838 T402A probably damaging Het
Ky T A 9: 102,537,627 V246E probably damaging Het
March1 A G 8: 66,468,492 T529A probably benign Het
Med18 C G 4: 132,459,883 V102L probably damaging Het
Mlst8 T C 17: 24,477,275 D160G probably damaging Het
Mthfd1 T C 12: 76,303,698 I470T probably benign Het
Muc1 C T 3: 89,229,159 probably benign Het
Mup8 G A 4: 60,220,322 L137F probably damaging Het
Mybpc1 A T 10: 88,542,330 L341* probably null Het
Nacad A G 11: 6,601,877 F438S probably benign Het
Necap2 C A 4: 141,078,212 probably null Het
Nifk T C 1: 118,332,348 L163S possibly damaging Het
Npsr1 A G 9: 24,289,997 I73V probably benign Het
Olfr1179 G A 2: 88,402,064 T290I probably benign Het
Olfr1186 T A 2: 88,526,194 C204S possibly damaging Het
Olfr142 A T 2: 90,252,777 C70* probably null Het
Olfr715 A G 7: 107,128,901 L164P probably damaging Het
Oog3 C T 4: 144,159,353 C225Y probably benign Het
Plagl2 C A 2: 153,235,943 K39N probably benign Het
Plcg2 T A 8: 117,557,319 D118E probably benign Het
Ppp4r3b A T 11: 29,211,786 K720I possibly damaging Het
Prmt3 A T 7: 49,829,016 T442S probably benign Het
Prr14l G A 5: 32,830,691 H487Y probably damaging Het
Psmb3 G A 11: 97,703,971 V63I probably benign Het
Psmc6 T A 14: 45,343,725 I326K possibly damaging Het
Ptcd1 T C 5: 145,155,075 T405A probably benign Het
Rbm33 G A 5: 28,410,745 V29M probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scarb1 T A 5: 125,284,719 I107F probably damaging Het
Slc39a12 A G 2: 14,389,375 S19G probably benign Het
Slc44a5 T C 3: 154,258,506 V503A probably benign Het
Slc9a9 T C 9: 94,670,086 S9P possibly damaging Het
Snrnp35 A C 5: 124,490,701 R192S possibly damaging Het
Tbx15 T C 3: 99,352,151 L446P probably damaging Het
Tlnrd1 A G 7: 83,882,597 F209L probably benign Het
Tmprss12 C T 15: 100,285,268 R164C probably damaging Het
Tnfsf4 T A 1: 161,417,073 F111Y possibly damaging Het
Trib2 A T 12: 15,793,639 M198K probably benign Het
Ttll8 A G 15: 88,914,304 S743P possibly damaging Het
Ush2a A T 1: 188,728,383 N2614Y probably benign Het
Usp6nl G A 2: 6,430,458 V343I possibly damaging Het
Vrtn C A 12: 84,650,242 Q589K probably benign Het
Zbed5 T A 5: 129,903,329 Y706* probably null Het
Zc3h10 A G 10: 128,544,684 V268A probably damaging Het
Zfp442 C T 2: 150,410,940 probably null Het
Other mutations in Gemin4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Gemin4 APN 11 76213485 missense probably benign 0.16
IGL01654:Gemin4 APN 11 76213398 missense probably damaging 1.00
IGL01656:Gemin4 APN 11 76213810 missense probably damaging 1.00
IGL02890:Gemin4 APN 11 76211264 missense probably damaging 1.00
IGL02967:Gemin4 APN 11 76212241 missense probably damaging 1.00
R0359:Gemin4 UTSW 11 76212162 missense probably benign 0.02
R0413:Gemin4 UTSW 11 76211322 missense probably benign 0.00
R1538:Gemin4 UTSW 11 76211161 missense probably benign 0.00
R1632:Gemin4 UTSW 11 76210989 missense probably benign 0.26
R1762:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1783:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1784:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1785:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1786:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R1835:Gemin4 UTSW 11 76213296 missense possibly damaging 0.62
R2007:Gemin4 UTSW 11 76212618 missense possibly damaging 0.78
R2117:Gemin4 UTSW 11 76211001 missense possibly damaging 0.59
R2131:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2133:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2140:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2141:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R2142:Gemin4 UTSW 11 76211050 missense probably damaging 1.00
R3937:Gemin4 UTSW 11 76212888 missense probably damaging 1.00
R4112:Gemin4 UTSW 11 76212819 missense probably damaging 0.99
R4444:Gemin4 UTSW 11 76212091 missense probably benign 0.00
R5502:Gemin4 UTSW 11 76213401 nonsense probably null
R5702:Gemin4 UTSW 11 76210837 missense probably benign 0.01
R5744:Gemin4 UTSW 11 76212165 missense probably damaging 1.00
R6044:Gemin4 UTSW 11 76212934 missense probably benign
R6924:Gemin4 UTSW 11 76212336 missense probably damaging 1.00
R7278:Gemin4 UTSW 11 76212106 missense probably damaging 0.98
R7286:Gemin4 UTSW 11 76212753 missense probably damaging 0.96
R7288:Gemin4 UTSW 11 76213380 missense possibly damaging 0.60
R7358:Gemin4 UTSW 11 76213452 nonsense probably null
R7572:Gemin4 UTSW 11 76213582 missense probably damaging 1.00
R8132:Gemin4 UTSW 11 76212913 missense probably benign 0.25
R8345:Gemin4 UTSW 11 76210779 missense probably damaging 1.00
R8695:Gemin4 UTSW 11 76211830 missense probably damaging 1.00
Z1176:Gemin4 UTSW 11 76217579 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTCAACAGGTCAGAAGTTGTTG -3'
(R):5'- AACTGGCTTCCTTTGGACGG -3'

Sequencing Primer
(F):5'- ACAGGTCAGAAGTTGTTGATCTTTTG -3'
(R):5'- CCTTTGGACGGTTGGAGCC -3'
Posted On2018-11-06