Incidental Mutation 'R6931:Fam171a2'
ID540047
Institutional Source Beutler Lab
Gene Symbol Fam171a2
Ensembl Gene ENSMUSG00000034685
Gene Namefamily with sequence similarity 171, member A2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6931 (G1)
Quality Score209.009
Status Validated
Chromosome11
Chromosomal Location102436981-102447682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102438434 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 500 (S500P)
Ref Sequence ENSEMBL: ENSMUSP00000038486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049057] [ENSMUST00000049460] [ENSMUST00000125819] [ENSMUST00000129997]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049057
AA Change: S500P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038486
Gene: ENSMUSG00000034685
AA Change: S500P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPF0560 41 820 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049460
SMART Domains Protein: ENSMUSP00000046340
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
GRAN 74 125 1.32e-22 SMART
GRAN 138 190 7.38e-26 SMART
GRAN 220 272 5.76e-28 SMART
GRAN 295 346 1.19e-29 SMART
GRAN 377 427 1.84e-26 SMART
GRAN 455 506 7.1e-28 SMART
GRAN 530 581 1.48e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125819
SMART Domains Protein: ENSMUSP00000134948
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 42 72 5.03e-4 SMART
GRAN 100 151 7.1e-28 SMART
GRAN 175 226 1.48e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129997
SMART Domains Protein: ENSMUSP00000135739
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GRAN 61 112 1.32e-22 SMART
GRAN 125 177 7.38e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177428
SMART Domains Protein: ENSMUSP00000134893
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 1 49 8.68e-23 SMART
GRAN 77 128 7.1e-28 SMART
GRAN 152 180 3.98e-2 SMART
low complexity region 244 259 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,548 T172A possibly damaging Het
2310003L06Rik T A 5: 87,970,702 I15N probably damaging Het
2900092C05Rik T A 7: 12,512,596 S6R unknown Het
Abca6 T A 11: 110,244,328 L210F probably benign Het
Abcc4 T C 14: 118,527,988 Q919R probably damaging Het
Adcy1 A G 11: 7,150,884 D811G possibly damaging Het
Akna A G 4: 63,387,102 S476P probably benign Het
Ankrd49 T C 9: 14,782,826 N15S probably benign Het
Apcdd1 A G 18: 62,933,908 D31G probably damaging Het
Aplp1 G T 7: 30,443,200 R106S probably damaging Het
Arhgap40 T C 2: 158,531,218 L132S probably benign Het
Atp8b5 G T 4: 43,364,108 probably null Het
Axl T C 7: 25,761,433 D717G probably damaging Het
Bub1 T A 2: 127,801,382 D1014V probably damaging Het
Cacna2d4 T A 6: 119,282,234 V603E possibly damaging Het
Cnot11 G C 1: 39,539,921 C289S probably damaging Het
Coasy A G 11: 101,083,581 H191R probably benign Het
Cyp11a1 A T 9: 58,025,120 N341Y possibly damaging Het
Cyp1a2 T C 9: 57,682,156 N125S probably benign Het
Cyp2j8 A T 4: 96,444,781 probably null Het
Dnah9 A T 11: 66,117,626 I791K possibly damaging Het
Ecm2 A T 13: 49,529,011 Q505H probably benign Het
Fam135a T A 1: 24,085,487 M1L probably damaging Het
Fat3 A G 9: 15,959,942 S3718P possibly damaging Het
Frem1 G A 4: 82,970,677 P1085S probably damaging Het
Gcfc2 A G 6: 81,942,985 I390V probably benign Het
Gemin4 A G 11: 76,210,956 L993P probably damaging Het
Ggnbp2 T A 11: 84,833,167 D647V probably damaging Het
Gm7534 A T 4: 134,193,153 M567K probably benign Het
Gpr84 A C 15: 103,309,014 L212R probably damaging Het
Hnrnpu T C 1: 178,331,432 probably benign Het
Hspg2 G T 4: 137,540,720 C2116F probably damaging Het
Icam4 T A 9: 21,030,451 V249E probably damaging Het
Itga1 T C 13: 115,001,563 N429D probably benign Het
Kcns1 T C 2: 164,164,838 T402A probably damaging Het
Ky T A 9: 102,537,627 V246E probably damaging Het
March1 A G 8: 66,468,492 T529A probably benign Het
Med18 C G 4: 132,459,883 V102L probably damaging Het
Mlst8 T C 17: 24,477,275 D160G probably damaging Het
Mthfd1 T C 12: 76,303,698 I470T probably benign Het
Muc1 C T 3: 89,229,159 probably benign Het
Mup8 G A 4: 60,220,322 L137F probably damaging Het
Mybpc1 A T 10: 88,542,330 L341* probably null Het
Nacad A G 11: 6,601,877 F438S probably benign Het
Necap2 C A 4: 141,078,212 probably null Het
Nifk T C 1: 118,332,348 L163S possibly damaging Het
Npsr1 A G 9: 24,289,997 I73V probably benign Het
Olfr1179 G A 2: 88,402,064 T290I probably benign Het
Olfr1186 T A 2: 88,526,194 C204S possibly damaging Het
Olfr142 A T 2: 90,252,777 C70* probably null Het
Olfr715 A G 7: 107,128,901 L164P probably damaging Het
Oog3 C T 4: 144,159,353 C225Y probably benign Het
Plagl2 C A 2: 153,235,943 K39N probably benign Het
Plcg2 T A 8: 117,557,319 D118E probably benign Het
Ppp4r3b A T 11: 29,211,786 K720I possibly damaging Het
Prmt3 A T 7: 49,829,016 T442S probably benign Het
Prr14l G A 5: 32,830,691 H487Y probably damaging Het
Psmb3 G A 11: 97,703,971 V63I probably benign Het
Psmc6 T A 14: 45,343,725 I326K possibly damaging Het
Ptcd1 T C 5: 145,155,075 T405A probably benign Het
Rbm33 G A 5: 28,410,745 V29M probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scarb1 T A 5: 125,284,719 I107F probably damaging Het
Slc39a12 A G 2: 14,389,375 S19G probably benign Het
Slc44a5 T C 3: 154,258,506 V503A probably benign Het
Slc9a9 T C 9: 94,670,086 S9P possibly damaging Het
Snrnp35 A C 5: 124,490,701 R192S possibly damaging Het
Tbx15 T C 3: 99,352,151 L446P probably damaging Het
Tlnrd1 A G 7: 83,882,597 F209L probably benign Het
Tmprss12 C T 15: 100,285,268 R164C probably damaging Het
Tnfsf4 T A 1: 161,417,073 F111Y possibly damaging Het
Trib2 A T 12: 15,793,639 M198K probably benign Het
Ttll8 A G 15: 88,914,304 S743P possibly damaging Het
Ush2a A T 1: 188,728,383 N2614Y probably benign Het
Usp6nl G A 2: 6,430,458 V343I possibly damaging Het
Vrtn C A 12: 84,650,242 Q589K probably benign Het
Zbed5 T A 5: 129,903,329 Y706* probably null Het
Zc3h10 A G 10: 128,544,684 V268A probably damaging Het
Zfp442 C T 2: 150,410,940 probably null Het
Other mutations in Fam171a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Fam171a2 APN 11 102437848 missense possibly damaging 0.92
IGL01898:Fam171a2 APN 11 102439756 missense possibly damaging 0.88
IGL02477:Fam171a2 APN 11 102440028 missense probably benign 0.00
IGL03272:Fam171a2 APN 11 102444118 missense possibly damaging 0.58
R0102:Fam171a2 UTSW 11 102444113 missense possibly damaging 0.88
R0102:Fam171a2 UTSW 11 102444113 missense possibly damaging 0.88
R0632:Fam171a2 UTSW 11 102437881 missense probably damaging 0.99
R0733:Fam171a2 UTSW 11 102439722 missense possibly damaging 0.83
R1005:Fam171a2 UTSW 11 102440181 missense probably benign 0.05
R1323:Fam171a2 UTSW 11 102444125 missense probably damaging 0.99
R1323:Fam171a2 UTSW 11 102444125 missense probably damaging 0.99
R2425:Fam171a2 UTSW 11 102438361 missense possibly damaging 0.88
R4838:Fam171a2 UTSW 11 102438685 missense possibly damaging 0.88
R4858:Fam171a2 UTSW 11 102440156 missense probably damaging 1.00
R5119:Fam171a2 UTSW 11 102438733 missense probably damaging 0.97
R5384:Fam171a2 UTSW 11 102437867 missense possibly damaging 0.51
R5386:Fam171a2 UTSW 11 102437867 missense possibly damaging 0.51
R5408:Fam171a2 UTSW 11 102437518 missense possibly damaging 0.71
R5457:Fam171a2 UTSW 11 102437536 missense possibly damaging 0.92
R5732:Fam171a2 UTSW 11 102439981 missense possibly damaging 0.94
R6466:Fam171a2 UTSW 11 102439885 missense probably damaging 1.00
R7196:Fam171a2 UTSW 11 102438346 missense probably benign 0.04
R7261:Fam171a2 UTSW 11 102438074 missense probably damaging 0.98
R7295:Fam171a2 UTSW 11 102438238 missense possibly damaging 0.85
R7419:Fam171a2 UTSW 11 102438802 missense possibly damaging 0.95
R7422:Fam171a2 UTSW 11 102438665 missense probably benign 0.29
R7454:Fam171a2 UTSW 11 102439717 missense possibly damaging 0.88
R7606:Fam171a2 UTSW 11 102444176 missense possibly damaging 0.75
R7690:Fam171a2 UTSW 11 102437834 missense probably benign 0.04
R7754:Fam171a2 UTSW 11 102438563 missense probably benign 0.00
R7970:Fam171a2 UTSW 11 102437866 missense possibly damaging 0.93
R8060:Fam171a2 UTSW 11 102438610 missense possibly damaging 0.88
R8338:Fam171a2 UTSW 11 102438346 missense probably benign 0.10
Z1176:Fam171a2 UTSW 11 102447446 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTGAACAGCACCGGAATGG -3'
(R):5'- TGACTTCTTCCGTGCCAAAC -3'

Sequencing Primer
(F):5'- AATGGTGACCGAGCCGCTG -3'
(R):5'- GGTGCCGGGCTCAAGAG -3'
Posted On2018-11-06