Incidental Mutation 'R6931:Abcc4'
ID540055
Institutional Source Beutler Lab
Gene Symbol Abcc4
Ensembl Gene ENSMUSG00000032849
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 4
SynonymsMRP4, D630049P08Rik, MOAT-B
MMRRC Submission
Accession Numbers

Genbank: NM_001033336.3, NM_001163675.1, NM_001163676.1; Ensembl: ENSMUST00000036554

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6931 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location118482692-118706219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118527988 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 919 (Q919R)
Ref Sequence ENSEMBL: ENSMUSP00000129677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036554] [ENSMUST00000166646]
Predicted Effect probably damaging
Transcript: ENSMUST00000036554
AA Change: Q994R

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042186
Gene: ENSMUSG00000032849
AA Change: Q994R

DomainStartEndE-ValueType
Pfam:ABC_membrane 92 365 4.5e-37 PFAM
AAA 437 610 5.71e-12 SMART
Pfam:ABC_membrane 714 993 4.2e-47 PFAM
AAA 1067 1251 2.02e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166646
AA Change: Q919R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129677
Gene: ENSMUSG00000032849
AA Change: Q919R

DomainStartEndE-ValueType
Pfam:ABC_membrane 98 290 4.1e-22 PFAM
AAA 362 535 5.71e-12 SMART
Pfam:ABC_membrane 638 922 4.6e-39 PFAM
AAA 992 1176 2.02e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This family member plays a role in cellular detoxification as a pump for its substrate, organic anions. It may also function in prostaglandin-mediated cAMP signaling in ciliogenesis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice are viable and fertile. Homozygotes for one null allele display impaired organic anion transport in the blood-brain and blood-cerebrospinal fluid barriers and kidney. Homozygotes for a second null allele display hypoalgesia and abnormal PGE2 physiology. [provided by MGI curators]
Allele List at MGI

All alleles(143) : Targeted, knock-out(2) Gene trapped(141)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,548 T172A possibly damaging Het
2310003L06Rik T A 5: 87,970,702 I15N probably damaging Het
2900092C05Rik T A 7: 12,512,596 S6R unknown Het
Abca6 T A 11: 110,244,328 L210F probably benign Het
Adcy1 A G 11: 7,150,884 D811G possibly damaging Het
Akna A G 4: 63,387,102 S476P probably benign Het
Ankrd49 T C 9: 14,782,826 N15S probably benign Het
Apcdd1 A G 18: 62,933,908 D31G probably damaging Het
Aplp1 G T 7: 30,443,200 R106S probably damaging Het
Arhgap40 T C 2: 158,531,218 L132S probably benign Het
Atp8b5 G T 4: 43,364,108 probably null Het
Axl T C 7: 25,761,433 D717G probably damaging Het
Bub1 T A 2: 127,801,382 D1014V probably damaging Het
Cacna2d4 T A 6: 119,282,234 V603E possibly damaging Het
Cnot11 G C 1: 39,539,921 C289S probably damaging Het
Coasy A G 11: 101,083,581 H191R probably benign Het
Cyp11a1 A T 9: 58,025,120 N341Y possibly damaging Het
Cyp1a2 T C 9: 57,682,156 N125S probably benign Het
Cyp2j8 A T 4: 96,444,781 probably null Het
Dnah9 A T 11: 66,117,626 I791K possibly damaging Het
Ecm2 A T 13: 49,529,011 Q505H probably benign Het
Fam135a T A 1: 24,085,487 M1L probably damaging Het
Fam171a2 A G 11: 102,438,434 S500P possibly damaging Het
Fat3 A G 9: 15,959,942 S3718P possibly damaging Het
Frem1 G A 4: 82,970,677 P1085S probably damaging Het
Gcfc2 A G 6: 81,942,985 I390V probably benign Het
Gemin4 A G 11: 76,210,956 L993P probably damaging Het
Ggnbp2 T A 11: 84,833,167 D647V probably damaging Het
Gm7534 A T 4: 134,193,153 M567K probably benign Het
Gpr84 A C 15: 103,309,014 L212R probably damaging Het
Hnrnpu T C 1: 178,331,432 probably benign Het
Hspg2 G T 4: 137,540,720 C2116F probably damaging Het
Icam4 T A 9: 21,030,451 V249E probably damaging Het
Itga1 T C 13: 115,001,563 N429D probably benign Het
Kcns1 T C 2: 164,164,838 T402A probably damaging Het
Ky T A 9: 102,537,627 V246E probably damaging Het
March1 A G 8: 66,468,492 T529A probably benign Het
Med18 C G 4: 132,459,883 V102L probably damaging Het
Mlst8 T C 17: 24,477,275 D160G probably damaging Het
Mthfd1 T C 12: 76,303,698 I470T probably benign Het
Muc1 C T 3: 89,229,159 probably benign Het
Mup8 G A 4: 60,220,322 L137F probably damaging Het
Mybpc1 A T 10: 88,542,330 L341* probably null Het
Nacad A G 11: 6,601,877 F438S probably benign Het
Necap2 C A 4: 141,078,212 probably null Het
Nifk T C 1: 118,332,348 L163S possibly damaging Het
Npsr1 A G 9: 24,289,997 I73V probably benign Het
Olfr1179 G A 2: 88,402,064 T290I probably benign Het
Olfr1186 T A 2: 88,526,194 C204S possibly damaging Het
Olfr142 A T 2: 90,252,777 C70* probably null Het
Olfr715 A G 7: 107,128,901 L164P probably damaging Het
Oog3 C T 4: 144,159,353 C225Y probably benign Het
Plagl2 C A 2: 153,235,943 K39N probably benign Het
Plcg2 T A 8: 117,557,319 D118E probably benign Het
Ppp4r3b A T 11: 29,211,786 K720I possibly damaging Het
Prmt3 A T 7: 49,829,016 T442S probably benign Het
Prr14l G A 5: 32,830,691 H487Y probably damaging Het
Psmb3 G A 11: 97,703,971 V63I probably benign Het
Psmc6 T A 14: 45,343,725 I326K possibly damaging Het
Ptcd1 T C 5: 145,155,075 T405A probably benign Het
Rbm33 G A 5: 28,410,745 V29M probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scarb1 T A 5: 125,284,719 I107F probably damaging Het
Slc39a12 A G 2: 14,389,375 S19G probably benign Het
Slc44a5 T C 3: 154,258,506 V503A probably benign Het
Slc9a9 T C 9: 94,670,086 S9P possibly damaging Het
Snrnp35 A C 5: 124,490,701 R192S possibly damaging Het
Tbx15 T C 3: 99,352,151 L446P probably damaging Het
Tlnrd1 A G 7: 83,882,597 F209L probably benign Het
Tmprss12 C T 15: 100,285,268 R164C probably damaging Het
Tnfsf4 T A 1: 161,417,073 F111Y possibly damaging Het
Trib2 A T 12: 15,793,639 M198K probably benign Het
Ttll8 A G 15: 88,914,304 S743P possibly damaging Het
Ush2a A T 1: 188,728,383 N2614Y probably benign Het
Usp6nl G A 2: 6,430,458 V343I possibly damaging Het
Vrtn C A 12: 84,650,242 Q589K probably benign Het
Zbed5 T A 5: 129,903,329 Y706* probably null Het
Zc3h10 A G 10: 128,544,684 V268A probably damaging Het
Zfp442 C T 2: 150,410,940 probably null Het
Other mutations in Abcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Abcc4 APN 14 118528997 missense probably benign 0.03
IGL01152:Abcc4 APN 14 118599385 missense probably damaging 1.00
IGL01511:Abcc4 APN 14 118599341 missense probably benign 0.03
IGL01604:Abcc4 APN 14 118527994 missense possibly damaging 0.94
IGL01725:Abcc4 APN 14 118500829 missense probably damaging 1.00
IGL01828:Abcc4 APN 14 118553279 splice site probably benign
IGL02174:Abcc4 APN 14 118500742 missense probably damaging 0.98
IGL02391:Abcc4 APN 14 118553352 missense probably damaging 1.00
IGL02500:Abcc4 APN 14 118618926 missense possibly damaging 0.47
IGL02598:Abcc4 APN 14 118668369 nonsense probably null
IGL02668:Abcc4 APN 14 118611475 missense probably damaging 1.00
IGL02708:Abcc4 APN 14 118500801 missense probably damaging 1.00
IGL02859:Abcc4 APN 14 118516500 missense probably damaging 1.00
IGL03249:Abcc4 APN 14 118627706 splice site probably benign
IGL03257:Abcc4 APN 14 118615211 missense probably benign 0.01
IGL03298:Abcc4 APN 14 118611468 missense probably damaging 1.00
1mM(1):Abcc4 UTSW 14 118629656 nonsense probably null
R0743:Abcc4 UTSW 14 118553288 missense possibly damaging 0.90
R0884:Abcc4 UTSW 14 118553288 missense possibly damaging 0.90
R1139:Abcc4 UTSW 14 118500840 missense possibly damaging 0.56
R1238:Abcc4 UTSW 14 118597639 splice site probably benign
R1588:Abcc4 UTSW 14 118534072 missense probably benign 0.01
R1678:Abcc4 UTSW 14 118594894 missense probably benign 0.08
R1785:Abcc4 UTSW 14 118553349 missense probably damaging 0.99
R1786:Abcc4 UTSW 14 118553349 missense probably damaging 0.99
R1961:Abcc4 UTSW 14 118611456 missense probably damaging 0.98
R1961:Abcc4 UTSW 14 118611459 missense possibly damaging 0.92
R1993:Abcc4 UTSW 14 118526282 missense probably benign 0.02
R2025:Abcc4 UTSW 14 118553325 missense probably benign 0.13
R3613:Abcc4 UTSW 14 118627451 critical splice donor site probably null
R3864:Abcc4 UTSW 14 118616415 missense probably benign
R4274:Abcc4 UTSW 14 118629622 missense probably damaging 1.00
R4459:Abcc4 UTSW 14 118599393 missense probably benign 0.11
R4601:Abcc4 UTSW 14 118632163 missense probably benign 0.00
R4665:Abcc4 UTSW 14 118529002 missense probably benign
R4678:Abcc4 UTSW 14 118627691 missense probably damaging 0.97
R4771:Abcc4 UTSW 14 118484384 missense probably benign 0.00
R4962:Abcc4 UTSW 14 118668399 missense probably benign 0.33
R4997:Abcc4 UTSW 14 118516503 nonsense probably null
R5273:Abcc4 UTSW 14 118594821 missense possibly damaging 0.76
R5526:Abcc4 UTSW 14 118631037 missense probably benign 0.10
R5652:Abcc4 UTSW 14 118618927 missense probably benign 0.00
R5820:Abcc4 UTSW 14 118604195 missense probably benign 0.14
R5873:Abcc4 UTSW 14 118526290 missense probably benign 0.00
R6008:Abcc4 UTSW 14 118490566 missense possibly damaging 0.63
R6080:Abcc4 UTSW 14 118669050 missense possibly damaging 0.75
R6222:Abcc4 UTSW 14 118529956 missense probably damaging 1.00
R6919:Abcc4 UTSW 14 118594894 missense probably benign 0.08
R7013:Abcc4 UTSW 14 118526343 missense probably benign
R7055:Abcc4 UTSW 14 118594785 nonsense probably null
R7146:Abcc4 UTSW 14 118615181 missense probably damaging 1.00
R7365:Abcc4 UTSW 14 118627654 missense probably damaging 1.00
R7402:Abcc4 UTSW 14 118706075 missense probably damaging 1.00
R7438:Abcc4 UTSW 14 118616446 missense probably benign 0.01
R7528:Abcc4 UTSW 14 118529905 missense probably damaging 0.99
R7674:Abcc4 UTSW 14 118611487 missense probably damaging 1.00
R7769:Abcc4 UTSW 14 118615270 frame shift probably null
R7823:Abcc4 UTSW 14 118534072 missense probably benign 0.01
R7847:Abcc4 UTSW 14 118627480 missense probably damaging 1.00
R8044:Abcc4 UTSW 14 118615270 frame shift probably null
R8214:Abcc4 UTSW 14 118500841 missense probably benign 0.35
R8264:Abcc4 UTSW 14 118594842 missense possibly damaging 0.81
R8309:Abcc4 UTSW 14 118616392 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACATAGCATACATGAGACAGAG -3'
(R):5'- GAAAACTCCGGCTGTATACCAC -3'

Sequencing Primer
(F):5'- CATTAACATTAAACAGATGGGAGCG -3'
(R):5'- CACTTGTTGGGTCCTCCTGTAAG -3'
Posted On2018-11-06