Mutagenetix > Incidental Mutation

Incidental Mutation 'R6931:Apcdd1'

540060

Institutional Source

Beutler Lab

Gene Symbol

Apcdd1

Ensembl Gene

ENSMUSG00000071847

Gene Name

adenomatosis polyposis coli down-regulated 1

Synonyms

Drapc1, EIG180

MMRRC Submission

045326-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.135) question?

Stock #

R6931 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62922327-62953195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62933908 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 31 (D31G)

Ref Sequence

ENSEMBL: ENSMUSP00000125868 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096554] [ENSMUST00000163716]

AlphaFold

Q3U128

Predicted Effect

probably damaging
Transcript: ENSMUST00000096554
AA Change: D31G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000094302
Gene: ENSMUSG00000071847
AA Change: D31G

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163716
AA Change: D31G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125868
Gene: ENSMUSG00000071847
AA Change: D31G

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
APCDDC	51	283	3.3e-140	SMART
APCDDC	284	500	6.26e-91	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an inhibitor of the Wnt signaling pathway. Mutations at this locus have been associated with hereditary hypotrichosis simplex. Increased expression of this gene may also be associated with colorectal carcinogenesis.[provided by RefSeq, Sep 2010]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	C	6: 96,165,548	T172A	possibly damaging	Het
2310003L06Rik	T	A	5: 87,970,702	I15N	probably damaging	Het
2900092C05Rik	T	A	7: 12,512,596	S6R	unknown	Het
Abca6	T	A	11: 110,244,328	L210F	probably benign	Het
Abcc4	T	C	14: 118,527,988	Q919R	probably damaging	Het
Adcy1	A	G	11: 7,150,884	D811G	possibly damaging	Het
Akna	A	G	4: 63,387,102	S476P	probably benign	Het
Ankrd49	T	C	9: 14,782,826	N15S	probably benign	Het
Aplp1	G	T	7: 30,443,200	R106S	probably damaging	Het
Arhgap40	T	C	2: 158,531,218	L132S	probably benign	Het
Atp8b5	G	T	4: 43,364,108		probably null	Het
Axl	T	C	7: 25,761,433	D717G	probably damaging	Het
Bub1	T	A	2: 127,801,382	D1014V	probably damaging	Het
Cacna2d4	T	A	6: 119,282,234	V603E	possibly damaging	Het
Cnot11	G	C	1: 39,539,921	C289S	probably damaging	Het
Coasy	A	G	11: 101,083,581	H191R	probably benign	Het
Cyp11a1	A	T	9: 58,025,120	N341Y	possibly damaging	Het
Cyp1a2	T	C	9: 57,682,156	N125S	probably benign	Het
Cyp2j8	A	T	4: 96,444,781		probably null	Het
Dnah9	A	T	11: 66,117,626	I791K	possibly damaging	Het
Ecm2	A	T	13: 49,529,011	Q505H	probably benign	Het
Fam135a	T	A	1: 24,085,487	M1L	probably damaging	Het
Fam171a2	A	G	11: 102,438,434	S500P	possibly damaging	Het
Fat3	A	G	9: 15,959,942	S3718P	possibly damaging	Het
Frem1	G	A	4: 82,970,677	P1085S	probably damaging	Het
Gcfc2	A	G	6: 81,942,985	I390V	probably benign	Het
Gemin4	A	G	11: 76,210,956	L993P	probably damaging	Het
Ggnbp2	T	A	11: 84,833,167	D647V	probably damaging	Het
Gm7534	A	T	4: 134,193,153	M567K	probably benign	Het
Gpr84	A	C	15: 103,309,014	L212R	probably damaging	Het
Hnrnpu	T	C	1: 178,331,432		probably benign	Het
Hspg2	G	T	4: 137,540,720	C2116F	probably damaging	Het
Icam4	T	A	9: 21,030,451	V249E	probably damaging	Het
Itga1	T	C	13: 115,001,563	N429D	probably benign	Het
Kcns1	T	C	2: 164,164,838	T402A	probably damaging	Het
Ky	T	A	9: 102,537,627	V246E	probably damaging	Het
March1	A	G	8: 66,468,492	T529A	probably benign	Het
Med18	C	G	4: 132,459,883	V102L	probably damaging	Het
Mlst8	T	C	17: 24,477,275	D160G	probably damaging	Het
Mthfd1	T	C	12: 76,303,698	I470T	probably benign	Het
Muc1	C	T	3: 89,229,159		probably benign	Het
Mup8	G	A	4: 60,220,322	L137F	probably damaging	Het
Mybpc1	A	T	10: 88,542,330	L341*	probably null	Het
Nacad	A	G	11: 6,601,877	F438S	probably benign	Het
Necap2	C	A	4: 141,078,212		probably null	Het
Nifk	T	C	1: 118,332,348	L163S	possibly damaging	Het
Npsr1	A	G	9: 24,289,997	I73V	probably benign	Het
Olfr1179	G	A	2: 88,402,064	T290I	probably benign	Het
Olfr1186	T	A	2: 88,526,194	C204S	possibly damaging	Het
Olfr142	A	T	2: 90,252,777	C70*	probably null	Het
Olfr715	A	G	7: 107,128,901	L164P	probably damaging	Het
Oog3	C	T	4: 144,159,353	C225Y	probably benign	Het
Plagl2	C	A	2: 153,235,943	K39N	probably benign	Het
Plcg2	T	A	8: 117,557,319	D118E	probably benign	Het
Ppp4r3b	A	T	11: 29,211,786	K720I	possibly damaging	Het
Prmt3	A	T	7: 49,829,016	T442S	probably benign	Het
Prr14l	G	A	5: 32,830,691	H487Y	probably damaging	Het
Psmb3	G	A	11: 97,703,971	V63I	probably benign	Het
Psmc6	T	A	14: 45,343,725	I326K	possibly damaging	Het
Ptcd1	T	C	5: 145,155,075	T405A	probably benign	Het
Rbm33	G	A	5: 28,410,745	V29M	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Scarb1	T	A	5: 125,284,719	I107F	probably damaging	Het
Slc39a12	A	G	2: 14,389,375	S19G	probably benign	Het
Slc44a5	T	C	3: 154,258,506	V503A	probably benign	Het
Slc9a9	T	C	9: 94,670,086	S9P	possibly damaging	Het
Snrnp35	A	C	5: 124,490,701	R192S	possibly damaging	Het
Tbx15	T	C	3: 99,352,151	L446P	probably damaging	Het
Tlnrd1	A	G	7: 83,882,597	F209L	probably benign	Het
Tmprss12	C	T	15: 100,285,268	R164C	probably damaging	Het
Tnfsf4	T	A	1: 161,417,073	F111Y	possibly damaging	Het
Trib2	A	T	12: 15,793,639	M198K	probably benign	Het
Ttll8	A	G	15: 88,914,304	S743P	possibly damaging	Het
Ush2a	A	T	1: 188,728,383	N2614Y	probably benign	Het
Usp6nl	G	A	2: 6,430,458	V343I	possibly damaging	Het
Vrtn	C	A	12: 84,650,242	Q589K	probably benign	Het
Zbed5	T	A	5: 129,903,329	Y706*	probably null	Het
Zc3h10	A	G	10: 128,544,684	V268A	probably damaging	Het
Zfp442	C	T	2: 150,410,940		probably null	Het

Other mutations in Apcdd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00805:Apcdd1	APN	18	62933865	splice site	probably benign
IGL01522:Apcdd1	APN	18	62952115	missense	possibly damaging	0.50
IGL01637:Apcdd1	APN	18	62937286	missense	probably damaging	1.00
IGL02069:Apcdd1	APN	18	62949983	missense	probably damaging	1.00
IGL02183:Apcdd1	APN	18	62951854	missense	probably damaging	0.98
IGL02268:Apcdd1	APN	18	62950188	missense	probably damaging	0.99
IGL02664:Apcdd1	APN	18	62951820	splice site	probably benign
R0207:Apcdd1	UTSW	18	62950079	missense	probably benign	0.04
R0363:Apcdd1	UTSW	18	62937097	missense	possibly damaging	0.46
R0540:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0567:Apcdd1	UTSW	18	62934036	missense	possibly damaging	0.93
R0607:Apcdd1	UTSW	18	62951896	missense	possibly damaging	0.82
R0629:Apcdd1	UTSW	18	62933970	missense	probably damaging	1.00
R1118:Apcdd1	UTSW	18	62952024	missense	probably benign
R1178:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1180:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R1181:Apcdd1	UTSW	18	62937097	missense	probably damaging	1.00
R4363:Apcdd1	UTSW	18	62951932	missense	possibly damaging	0.95
R5534:Apcdd1	UTSW	18	62937034	missense	probably benign	0.01
R5622:Apcdd1	UTSW	18	62936902	splice site	probably null
R5771:Apcdd1	UTSW	18	62936956	missense	probably damaging	1.00
R5852:Apcdd1	UTSW	18	62937063	missense	probably damaging	1.00
R5934:Apcdd1	UTSW	18	62951869	missense	possibly damaging	0.72
R6109:Apcdd1	UTSW	18	62937366	missense	probably damaging	1.00
R6515:Apcdd1	UTSW	18	62951839	missense	probably damaging	1.00
R6625:Apcdd1	UTSW	18	62951858	missense	probably damaging	1.00
R6831:Apcdd1	UTSW	18	62950126	nonsense	probably null
R7018:Apcdd1	UTSW	18	62937049	missense	probably damaging	0.98
R7115:Apcdd1	UTSW	18	62936953	missense	probably damaging	1.00
R7148:Apcdd1	UTSW	18	62951845	missense	probably damaging	1.00
R7326:Apcdd1	UTSW	18	62952188	nonsense	probably null
R8025:Apcdd1	UTSW	18	62936908	missense	probably damaging	1.00
R8114:Apcdd1	UTSW	18	62950056	missense	probably damaging	1.00
R8261:Apcdd1	UTSW	18	62933903	missense	possibly damaging	0.86
R8404:Apcdd1	UTSW	18	62933915	missense	possibly damaging	0.66
R9015:Apcdd1	UTSW	18	62950086	missense	possibly damaging	0.93
R9040:Apcdd1	UTSW	18	62937343	missense	probably damaging	0.96
R9288:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9295:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9297:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9317:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9319:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9393:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9394:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9396:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9397:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9480:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9520:Apcdd1	UTSW	18	62950119	missense	possibly damaging	0.85
R9521:Apcdd1	UTSW	18	62922660	start gained	probably benign
R9599:Apcdd1	UTSW	18	62950198	critical splice donor site	probably null
X0028:Apcdd1	UTSW	18	62937130	missense	possibly damaging	0.59
Z1088:Apcdd1	UTSW	18	62937183	missense	probably benign	0.18
Z1177:Apcdd1	UTSW	18	62922691	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GATCTTCAAGAGTGTCCCCGAC -3'
(R):5'- TTCCCGTCTCAAATGCAGC -3'

Sequencing Primer
(F):5'- CGACTCTGGCATGGGAGTTC -3'
(R):5'- AAATGCAGCTCTTACCCTGTGG -3'

Posted On

2018-11-06