Incidental Mutation 'R6932:Lrrd1'
ID540081
Institutional Source Beutler Lab
Gene Symbol Lrrd1
Ensembl Gene ENSMUSG00000040367
Gene Nameleucine rich repeats and death domain containing 1
Synonyms4932412H11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R6932 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location3845173-3866596 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3851395 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 567 (K567E)
Ref Sequence ENSEMBL: ENSMUSP00000038675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044039] [ENSMUST00000143027]
Predicted Effect probably benign
Transcript: ENSMUST00000044039
AA Change: K567E

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038675
Gene: ENSMUSG00000040367
AA Change: K567E

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
LRR 181 203 3.18e1 SMART
LRR 204 226 7.8e1 SMART
LRR 227 249 5.26e0 SMART
LRR 250 272 3.98e1 SMART
LRR 273 294 2.33e1 SMART
LRR 296 318 2.14e1 SMART
LRR_TYP 319 342 1.45e-2 SMART
LRR 365 388 4.44e0 SMART
LRR 389 410 2.76e1 SMART
LRR 411 433 8.73e1 SMART
LRR 434 457 3.55e1 SMART
LRR 480 503 1.45e1 SMART
LRR 526 548 1.31e0 SMART
LRR 549 571 3.65e1 SMART
LRR 572 594 6.22e0 SMART
LRR 595 618 2.68e1 SMART
LRR 644 665 1.15e1 SMART
LRR 667 689 8.01e0 SMART
LRR 690 713 1.53e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143027
SMART Domains Protein: ENSMUSP00000122668
Gene: ENSMUSG00000040367

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik CA CAA 8: 13,734,865 probably null Het
Acads A T 5: 115,112,272 F198I probably damaging Het
Acy1 A G 9: 106,437,627 probably null Het
Adk A G 14: 21,076,308 M1V probably null Het
Ahi1 A G 10: 20,963,691 D167G probably benign Het
Ankrd16 T C 2: 11,786,243 V290A possibly damaging Het
Arhgef5 T A 6: 43,274,417 S701T possibly damaging Het
Atp13a5 C A 16: 29,281,951 M673I probably damaging Het
BC005624 T C 2: 30,978,928 D78G possibly damaging Het
Bcat2 C T 7: 45,589,321 H347Y probably damaging Het
Bpifb4 A G 2: 153,942,627 Y85C possibly damaging Het
Cdc42 T A 4: 137,322,621 probably null Het
Cep170 G A 1: 176,761,437 L541F possibly damaging Het
Cgrrf1 T A 14: 46,853,722 N234K probably benign Het
Ctrc C T 4: 141,841,568 C108Y probably damaging Het
Cyp2u1 C T 3: 131,298,296 V192M possibly damaging Het
Dhx38 A T 8: 109,552,675 L1013Q probably damaging Het
Dnah1 T A 14: 31,287,776 N1945I probably damaging Het
Dnah10 C G 5: 124,821,450 N3765K possibly damaging Het
Dnah17 C A 11: 118,060,079 R2906L possibly damaging Het
Dnajc10 C T 2: 80,331,336 T306I probably benign Het
Efemp2 T A 19: 5,480,245 C287S probably damaging Het
Efna1 T C 3: 89,272,784 R143G probably benign Het
Emilin1 A C 5: 30,917,077 N221H probably damaging Het
Epg5 A G 18: 77,948,609 T174A probably benign Het
Fam184b T A 5: 45,532,901 probably null Het
Fchsd2 T A 7: 101,277,414 C570* probably null Het
Gm4787 A T 12: 81,379,200 D61E probably benign Het
Gm7356 C T 17: 14,001,663 G35R probably damaging Het
Gm8220 A G 14: 44,288,188 T20A probably damaging Het
Hivep2 C T 10: 14,128,501 T281M probably damaging Het
Ighv2-9-1 A G 12: 113,770,072 V43A probably damaging Het
Klhl33 A T 14: 50,891,916 C619S probably benign Het
Kmt2a A T 9: 44,829,261 probably benign Het
Lax1 A G 1: 133,680,158 C282R probably benign Het
Luzp1 C T 4: 136,540,813 R116* probably null Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Macrod2 A T 2: 140,419,913 N38I probably damaging Het
Map3k14 A T 11: 103,242,132 I80N probably damaging Het
Mcm9 A G 10: 53,620,203 S368P probably benign Het
Mfge8 T C 7: 79,143,301 D139G probably benign Het
Mmp19 A T 10: 128,791,654 I54F probably benign Het
Myo15 G T 11: 60,499,494 W2114L probably damaging Het
Myo1a G T 10: 127,710,458 V277L probably benign Het
Myoc A G 1: 162,639,346 D28G probably damaging Het
Myrf G T 19: 10,219,560 N487K probably damaging Het
Olfr1093 C G 2: 86,786,155 L142V probably damaging Het
Olfr429 G A 1: 174,089,750 A237T probably damaging Het
Olfr703 G T 7: 106,844,802 G64* probably null Het
Omd T A 13: 49,590,234 F253L probably damaging Het
Papss1 T G 3: 131,599,971 I238S probably damaging Het
Pkhd1 A T 1: 20,562,451 F580Y probably benign Het
Polk T A 13: 96,516,681 K70N probably damaging Het
Ppig T A 2: 69,732,411 D31E probably benign Het
Ppp6r1 G T 7: 4,633,292 S766R possibly damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Reln T C 5: 21,985,857 I1511V probably benign Het
Rnh1 T C 7: 141,163,183 N268S probably damaging Het
Rpia A G 6: 70,773,440 V236A probably benign Het
Rpl10a G T 17: 28,329,450 V80L probably benign Het
Sap130 T G 18: 31,666,354 S295A possibly damaging Het
Sgms1 C T 19: 32,142,793 V238I probably benign Het
Sh3tc1 A G 5: 35,707,434 S470P probably benign Het
Slc25a32 A G 15: 39,097,589 V233A possibly damaging Het
Slc2a2 T C 3: 28,717,519 S158P probably benign Het
Slc6a2 A G 8: 92,996,025 Y550C probably benign Het
Slc7a9 C A 7: 35,452,511 T77K probably benign Het
Snd1 A T 6: 28,626,101 D385V probably benign Het
Ssh3 A T 19: 4,264,420 F369I probably damaging Het
Syk A G 13: 52,612,459 probably null Het
Tbc1d16 A G 11: 119,208,916 S211P probably damaging Het
Ttc3 A G 16: 94,443,453 T1439A probably benign Het
Usp18 A G 6: 121,252,514 M31V probably benign Het
Vav1 G T 17: 57,302,330 E415D possibly damaging Het
Vps13a A T 19: 16,678,075 V1863D probably benign Het
Xdh T A 17: 73,922,562 I299F probably damaging Het
Zc3h14 A G 12: 98,771,077 probably benign Het
Zfp345 G A 2: 150,473,411 H69Y probably damaging Het
Zfp652 G T 11: 95,763,841 V357L probably benign Het
Zfp712 A T 13: 67,040,827 Y545* probably null Het
Zgrf1 T C 3: 127,559,632 probably null Het
Other mutations in Lrrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Lrrd1 APN 5 3850573 missense possibly damaging 0.94
IGL00329:Lrrd1 APN 5 3850081 missense possibly damaging 0.94
IGL00674:Lrrd1 APN 5 3849773 missense possibly damaging 0.92
IGL00691:Lrrd1 APN 5 3863929 missense probably damaging 0.98
IGL00839:Lrrd1 APN 5 3850017 missense probably benign 0.00
IGL00911:Lrrd1 APN 5 3865689 missense probably benign 0.07
IGL01754:Lrrd1 APN 5 3851432 missense probably damaging 1.00
IGL01981:Lrrd1 APN 5 3851267 missense probably damaging 1.00
IGL02003:Lrrd1 APN 5 3849857 missense probably damaging 0.99
IGL02223:Lrrd1 APN 5 3850211 missense probably benign
IGL02477:Lrrd1 APN 5 3865770 missense probably benign
IGL02609:Lrrd1 APN 5 3858803 missense probably benign 0.26
IGL02833:Lrrd1 APN 5 3850709 missense probably damaging 0.98
IGL02886:Lrrd1 APN 5 3851534 missense probably benign 0.00
IGL02896:Lrrd1 APN 5 3851473 missense probably benign 0.08
R0045:Lrrd1 UTSW 5 3866418 missense possibly damaging 0.50
R0138:Lrrd1 UTSW 5 3851345 missense probably benign 0.04
R0305:Lrrd1 UTSW 5 3865707 missense probably damaging 1.00
R0346:Lrrd1 UTSW 5 3850215 missense probably benign 0.03
R0455:Lrrd1 UTSW 5 3866425 missense probably benign 0.21
R1717:Lrrd1 UTSW 5 3850580 missense probably damaging 0.99
R1719:Lrrd1 UTSW 5 3850483 splice site probably null
R1836:Lrrd1 UTSW 5 3865709 missense probably benign 0.36
R1951:Lrrd1 UTSW 5 3851488 missense probably damaging 1.00
R2199:Lrrd1 UTSW 5 3866478 missense possibly damaging 0.86
R3751:Lrrd1 UTSW 5 3850282 missense probably benign 0.37
R3752:Lrrd1 UTSW 5 3850282 missense probably benign 0.37
R3837:Lrrd1 UTSW 5 3850204 missense possibly damaging 0.73
R3862:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R3863:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R3864:Lrrd1 UTSW 5 3851248 missense probably benign 0.00
R4816:Lrrd1 UTSW 5 3851126 nonsense probably null
R5225:Lrrd1 UTSW 5 3858735 missense probably benign 0.00
R5721:Lrrd1 UTSW 5 3850619 missense probably benign 0.13
R5791:Lrrd1 UTSW 5 3851254 missense probably benign 0.11
R6077:Lrrd1 UTSW 5 3850837 missense probably benign 0.01
R6229:Lrrd1 UTSW 5 3863887 missense probably damaging 1.00
R6330:Lrrd1 UTSW 5 3850629 missense probably damaging 1.00
R6588:Lrrd1 UTSW 5 3851386 missense probably benign 0.19
R6734:Lrrd1 UTSW 5 3850226 missense possibly damaging 0.95
R7180:Lrrd1 UTSW 5 3851459 missense probably damaging 1.00
R7771:Lrrd1 UTSW 5 3866476 missense possibly damaging 0.84
R8356:Lrrd1 UTSW 5 3866509 missense probably benign 0.19
Z1176:Lrrd1 UTSW 5 3850025 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGCTGCTTCATTTAGAGTTG -3'
(R):5'- AGGTTGAGATTCCCCTAGGC -3'

Sequencing Primer
(F):5'- CAGCTGCTTCATTTAGAGTTGAATAG -3'
(R):5'- CTGACTTATATTCAGCTCCTCAAGAG -3'
Posted On2018-11-06