Mutagenetix > Incidental Mutations

Incidental Mutation 'R6932:Reln'

540082

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R6932 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21985857 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1511 (I1511V)

Ref Sequence

ENSEMBL: ENSMUSP00000058025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

PDB Structure

Crystal structure of the third repeat domain of reelin [X-RAY DIFFRACTION]
Crystal structure of two repeat fragment of reelin [X-RAY DIFFRACTION]
Structural basis for specific recognition of reelin by its receptors [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000062372
AA Change: I1511V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: I1511V

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161356
AA Change: I1511V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: I1511V

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932443I19Rik	CA	CAA	8: 13,734,865		probably null	Het
Acads	A	T	5: 115,112,272	F198I	probably damaging	Het
Acy1	A	G	9: 106,437,627		probably null	Het
Adk	A	G	14: 21,076,308	M1V	probably null	Het
Ahi1	A	G	10: 20,963,691	D167G	probably benign	Het
Ankrd16	T	C	2: 11,786,243	V290A	possibly damaging	Het
Arhgef5	T	A	6: 43,274,417	S701T	possibly damaging	Het
Atp13a5	C	A	16: 29,281,951	M673I	probably damaging	Het
BC005624	T	C	2: 30,978,928	D78G	possibly damaging	Het
Bcat2	C	T	7: 45,589,321	H347Y	probably damaging	Het
Bpifb4	A	G	2: 153,942,627	Y85C	possibly damaging	Het
Cdc42	T	A	4: 137,322,621		probably null	Het
Cep170	G	A	1: 176,761,437	L541F	possibly damaging	Het
Cgrrf1	T	A	14: 46,853,722	N234K	probably benign	Het
Ctrc	C	T	4: 141,841,568	C108Y	probably damaging	Het
Cyp2u1	C	T	3: 131,298,296	V192M	possibly damaging	Het
Dhx38	A	T	8: 109,552,675	L1013Q	probably damaging	Het
Dnah1	T	A	14: 31,287,776	N1945I	probably damaging	Het
Dnah10	C	G	5: 124,821,450	N3765K	possibly damaging	Het
Dnah17	C	A	11: 118,060,079	R2906L	possibly damaging	Het
Dnajc10	C	T	2: 80,331,336	T306I	probably benign	Het
Efemp2	T	A	19: 5,480,245	C287S	probably damaging	Het
Efna1	T	C	3: 89,272,784	R143G	probably benign	Het
Emilin1	A	C	5: 30,917,077	N221H	probably damaging	Het
Epg5	A	G	18: 77,948,609	T174A	probably benign	Het
Fam184b	T	A	5: 45,532,901		probably null	Het
Fchsd2	T	A	7: 101,277,414	C570*	probably null	Het
Gm4787	A	T	12: 81,379,200	D61E	probably benign	Het
Gm7356	C	T	17: 14,001,663	G35R	probably damaging	Het
Gm8220	A	G	14: 44,288,188	T20A	probably damaging	Het
Hivep2	C	T	10: 14,128,501	T281M	probably damaging	Het
Ighv2-9-1	A	G	12: 113,770,072	V43A	probably damaging	Het
Klhl33	A	T	14: 50,891,916	C619S	probably benign	Het
Kmt2a	A	T	9: 44,829,261		probably benign	Het
Lax1	A	G	1: 133,680,158	C282R	probably benign	Het
Lrrd1	A	G	5: 3,851,395	K567E	probably benign	Het
Luzp1	C	T	4: 136,540,813	R116*	probably null	Het
Lypd3	G	C	7: 24,638,433	G75R	probably damaging	Het
Macrod2	A	T	2: 140,419,913	N38I	probably damaging	Het
Map3k14	A	T	11: 103,242,132	I80N	probably damaging	Het
Mcm9	A	G	10: 53,620,203	S368P	probably benign	Het
Mfge8	T	C	7: 79,143,301	D139G	probably benign	Het
Mmp19	A	T	10: 128,791,654	I54F	probably benign	Het
Myo15	G	T	11: 60,499,494	W2114L	probably damaging	Het
Myo1a	G	T	10: 127,710,458	V277L	probably benign	Het
Myoc	A	G	1: 162,639,346	D28G	probably damaging	Het
Myrf	G	T	19: 10,219,560	N487K	probably damaging	Het
Olfr1093	C	G	2: 86,786,155	L142V	probably damaging	Het
Olfr429	G	A	1: 174,089,750	A237T	probably damaging	Het
Olfr703	G	T	7: 106,844,802	G64*	probably null	Het
Omd	T	A	13: 49,590,234	F253L	probably damaging	Het
Papss1	T	G	3: 131,599,971	I238S	probably damaging	Het
Pkhd1	A	T	1: 20,562,451	F580Y	probably benign	Het
Polk	T	A	13: 96,516,681	K70N	probably damaging	Het
Ppig	T	A	2: 69,732,411	D31E	probably benign	Het
Ppp6r1	G	T	7: 4,633,292	S766R	possibly damaging	Het
Rab11fip5	T	C	6: 85,341,558	D783G	probably benign	Het
Rnh1	T	C	7: 141,163,183	N268S	probably damaging	Het
Rpia	A	G	6: 70,773,440	V236A	probably benign	Het
Rpl10a	G	T	17: 28,329,450	V80L	probably benign	Het
Sap130	T	G	18: 31,666,354	S295A	possibly damaging	Het
Sgms1	C	T	19: 32,142,793	V238I	probably benign	Het
Sh3tc1	A	G	5: 35,707,434	S470P	probably benign	Het
Slc25a32	A	G	15: 39,097,589	V233A	possibly damaging	Het
Slc2a2	T	C	3: 28,717,519	S158P	probably benign	Het
Slc6a2	A	G	8: 92,996,025	Y550C	probably benign	Het
Slc7a9	C	A	7: 35,452,511	T77K	probably benign	Het
Snd1	A	T	6: 28,626,101	D385V	probably benign	Het
Ssh3	A	T	19: 4,264,420	F369I	probably damaging	Het
Syk	A	G	13: 52,612,459		probably null	Het
Tbc1d16	A	G	11: 119,208,916	S211P	probably damaging	Het
Ttc3	A	G	16: 94,443,453	T1439A	probably benign	Het
Usp18	A	G	6: 121,252,514	M31V	probably benign	Het
Vav1	G	T	17: 57,302,330	E415D	possibly damaging	Het
Vps13a	A	T	19: 16,678,075	V1863D	probably benign	Het
Xdh	T	A	17: 73,922,562	I299F	probably damaging	Het
Zc3h14	A	G	12: 98,771,077		probably benign	Het
Zfp345	G	A	2: 150,473,411	H69Y	probably damaging	Het
Zfp652	G	T	11: 95,763,841	V357L	probably benign	Het
Zfp712	A	T	13: 67,040,827	Y545*	probably null	Het
Zgrf1	T	C	3: 127,559,632		probably null	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22010127	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22045009	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22154950	missense	probably benign	0.01
IGL00755:Reln	APN	5	22060380	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22018850	critical splice donor site	probably null
IGL00900:Reln	APN	5	21980117	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21979666	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21986967	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21969033	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21919069	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22171251	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21969079	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21919175	nonsense	probably null
IGL01361:Reln	APN	5	21919021	missense	probably benign	0.06
IGL01446:Reln	APN	5	21969317	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22040405	missense	probably benign	0.40
IGL01612:Reln	APN	5	21896930	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21920438	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21947514	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22344246	nonsense	probably null
IGL01875:Reln	APN	5	21904717	missense	probably benign
IGL02013:Reln	APN	5	21950879	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21979016	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21909958	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21904731	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21910992	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21929134	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22080791	nonsense	probably null
IGL02408:Reln	APN	5	21901619	missense	probably benign	0.44
IGL02415:Reln	APN	5	21971951	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22040427	missense	probably benign	0.00
IGL02540:Reln	APN	5	22034752	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22103357	missense	probably benign	0.09
IGL02720:Reln	APN	5	21997941	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21885548	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21995365	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21910844	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21910836	missense	probably damaging	0.99
Fishing	UTSW	5	21896841	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22106060	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	21925371	missense	probably benign	0.01
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22004136	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22128649	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21948449	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0266:Reln	UTSW	5	21988776	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22227513	splice site	probably benign
R0333:Reln	UTSW	5	21929242	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21950822	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22048800	missense	probably damaging	0.98
R0506:Reln	UTSW	5	21920496	missense	probably damaging	0.97
R0534:Reln	UTSW	5	21947408	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22051276	splice site	probably benign
R0541:Reln	UTSW	5	21980109	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22010150	missense	probably benign	0.36
R0617:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22018869	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21913230	missense	probably benign	0.44
R0704:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22227628	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22034664	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22034775	missense	probably benign
R1163:Reln	UTSW	5	21899029	missense	probably benign	0.03
R1222:Reln	UTSW	5	21986955	missense	probably null	0.97
R1226:Reln	UTSW	5	21910866	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22128602	splice site	probably benign
R1532:Reln	UTSW	5	22034744	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21960378	missense	probably benign	0.01
R1565:Reln	UTSW	5	21925213	missense	probably benign	0.05
R1618:Reln	UTSW	5	22060368	missense	probably benign	0.01
R1636:Reln	UTSW	5	21998683	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21929086	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21955095	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22010289	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21979002	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22044962	critical splice donor site	probably null
R1991:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21942627	missense	probably benign	0.01
R2072:Reln	UTSW	5	21919177	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22019000	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21969085	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22048005	missense	probably benign	0.30
R2219:Reln	UTSW	5	21972047	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21987078	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21896786	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22154956	missense	probably benign	0.00
R2321:Reln	UTSW	5	21915020	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21979690	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22344369	missense	unknown
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22040420	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21995589	splice site	probably benign
R3713:Reln	UTSW	5	21904734	missense	probably damaging	0.99
R3770:Reln	UTSW	5	21948566	missense	probably damaging	1.00
R3836:Reln	UTSW	5	21911014	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21910849	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21979001	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21995366	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22227630	missense	probably benign	0.45
R4044:Reln	UTSW	5	22128632	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22034584	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21901743	missense	probably benign	0.44
R4615:Reln	UTSW	5	21972872	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22152463	missense	probably benign	0.17
R4720:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	21919222	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22049700	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22344185	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22018846	splice site	probably null
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4896:Reln	UTSW	5	21955238	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21979720	missense	probably benign	0.02
R4912:Reln	UTSW	5	21925193	missense	probably benign	0.29
R4922:Reln	UTSW	5	21995587	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21960426	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5020:Reln	UTSW	5	22034638	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21948512	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21896077	missense	probably benign	0.00
R5119:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5125:Reln	UTSW	5	21913241	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21948629	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21988765	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22103397	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22011163	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22039529	missense	probably benign
R5400:Reln	UTSW	5	21979714	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22004203	missense	probably benign	0.00
R5514:Reln	UTSW	5	21971885	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21932715	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22039665	nonsense	probably null
R5648:Reln	UTSW	5	21998572	missense	probably benign	0.04
R5649:Reln	UTSW	5	21901625	missense	probably benign	0.33
R5744:Reln	UTSW	5	22106083	missense	probably null	0.39
R5782:Reln	UTSW	5	22018056	missense	probably benign	0.01
R5815:Reln	UTSW	5	21947433	missense	probably damaging	0.99
R5838:Reln	UTSW	5	21899113	missense	probably damaging	0.97
R6162:Reln	UTSW	5	21911050	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21948596	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22060333	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22286944	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22152484	nonsense	probably null
R6351:Reln	UTSW	5	21901663	nonsense	probably null
R6369:Reln	UTSW	5	22051361	missense	probably benign	0.03
R6371:Reln	UTSW	5	21995513	missense	probably benign
R6374:Reln	UTSW	5	22080714	missense	probably benign	0.06
R6425:Reln	UTSW	5	21911020	nonsense	probably null
R6442:Reln	UTSW	5	21932776	missense	probably benign
R6445:Reln	UTSW	5	21919214	missense	probably benign	0.05
R6554:Reln	UTSW	5	21896840	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21929134	missense	probably damaging	1.00
R6768:Reln	UTSW	5	21978907	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22034570	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21899179	missense	probably benign	0.18
R6948:Reln	UTSW	5	21972035	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21976564	missense	probably damaging	1.00
R7085:Reln	UTSW	5	21915087	nonsense	probably null
R7091:Reln	UTSW	5	21899029	missense	probably null	0.08
R7135:Reln	UTSW	5	21976596	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22106097	missense	probably damaging	0.97
R7167:Reln	UTSW	5	21942620	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22047947	missense	probably damaging	1.00
R7256:Reln	UTSW	5	21978923	missense	probably benign	0.03
R7393:Reln	UTSW	5	21976351	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22051367	missense	probably damaging	0.99
R7400:Reln	UTSW	5	21971934	missense	probably damaging	0.99
R7426:Reln	UTSW	5	21971953	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22103435	missense	probably damaging	0.98
R7470:Reln	UTSW	5	21942741	missense	probably damaging	0.99
R7473:Reln	UTSW	5	21929127	missense	probably benign	0.25
R7501:Reln	UTSW	5	22227638	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R7544:Reln	UTSW	5	21976278	nonsense	probably null
R7588:Reln	UTSW	5	21885568	missense	probably benign	0.03
R7631:Reln	UTSW	5	21971935	missense	probably damaging	0.97
R7644:Reln	UTSW	5	21978931	missense	probably benign	0.39
R7834:Reln	UTSW	5	22039635	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22134692	missense	probably benign	0.00
R7938:Reln	UTSW	5	21950872	missense	probably damaging	0.97
R8006:Reln	UTSW	5	21899084	nonsense	probably null
R8062:Reln	UTSW	5	21971992	missense	probably benign	0.00
R8222:Reln	UTSW	5	21931477	nonsense	probably null
R8266:Reln	UTSW	5	22018087	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22004112	missense	probably damaging	1.00
R8487:Reln	UTSW	5	21899029	missense	probably benign	0.03
R8523:Reln	UTSW	5	22004231	missense	probably damaging	1.00
R8751:Reln	UTSW	5	21942674	missense	probably benign	0.37
R8801:Reln	UTSW	5	21950856	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	21925259	missense	probably damaging	0.98
Z1176:Reln	UTSW	5	21979024	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	21969241	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22004082	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22154959	missense	probably benign	0.05
Z1177:Reln	UTSW	5	22227636	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACATCAGACTTTGGGAGG -3'
(R):5'- ATGAGGTTGTTGTTCACATCAC -3'

Sequencing Primer
(F):5'- TGGTGGATCACAACCATCTG -3'
(R):5'- GAGGTTGTTGTTCACATCACTTAAC -3'

Posted On

2018-11-06