Mutagenetix > Incidental Mutations

Incidental Mutation 'R6932:Myo15'

540111

Institutional Source

Beutler Lab

Gene Symbol

Myo15

Ensembl Gene

ENSMUSG00000042678

Gene Name

myosin XV

Synonyms

sh2; sh-2; Myo15a

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6932 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60469339-60528369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 60499494 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Leucine at position 2114 (W2114L)

Ref Sequence

ENSEMBL: ENSMUSP00000091686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071880] [ENSMUST00000081823] [ENSMUST00000094135]

Predicted Effect

probably damaging
Transcript: ENSMUST00000071880
AA Change: W2132L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000071777
Gene: ENSMUSG00000042678
AA Change: W2132L

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	87	100	N/A	INTRINSIC
low complexity region	107	120	N/A	INTRINSIC
low complexity region	269	292	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
low complexity region	311	325	N/A	INTRINSIC
low complexity region	349	384	N/A	INTRINSIC
low complexity region	425	435	N/A	INTRINSIC
low complexity region	487	498	N/A	INTRINSIC
low complexity region	502	509	N/A	INTRINSIC
low complexity region	653	681	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
low complexity region	737	747	N/A	INTRINSIC
low complexity region	758	775	N/A	INTRINSIC
low complexity region	781	792	N/A	INTRINSIC
low complexity region	796	809	N/A	INTRINSIC
low complexity region	825	849	N/A	INTRINSIC
low complexity region	883	897	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
low complexity region	1115	1130	N/A	INTRINSIC
MYSc	1200	1884	N/A	SMART
IQ	1885	1907	1.63e-1	SMART
IQ	1908	1930	1.77e-2	SMART
IQ	1931	1953	2.97e2	SMART
low complexity region	1955	1974	N/A	INTRINSIC
low complexity region	1992	2006	N/A	INTRINSIC
MyTH4	2049	2195	1.8e-42	SMART
low complexity region	2396	2405	N/A	INTRINSIC
low complexity region	2451	2461	N/A	INTRINSIC
Blast:MYSc	2665	2848	2e-14	BLAST
SH3	2851	2933	1.55e-4	SMART
low complexity region	2949	2962	N/A	INTRINSIC
MyTH4	3031	3185	5.59e-48	SMART
B41	3188	3400	6.94e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000081823
AA Change: W927L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000080507
Gene: ENSMUSG00000042678
AA Change: W927L

Domain	Start	End	E-Value	Type
MYSc	13	697	N/A	SMART
IQ	698	720	1.63e-1	SMART
IQ	721	743	1.77e-2	SMART
IQ	744	766	2.97e2	SMART
low complexity region	787	801	N/A	INTRINSIC
MyTH4	844	990	1.8e-42	SMART
low complexity region	1191	1200	N/A	INTRINSIC
low complexity region	1246	1256	N/A	INTRINSIC
Blast:MYSc	1460	1643	7e-15	BLAST
SH3	1646	1728	1.55e-4	SMART
low complexity region	1744	1757	N/A	INTRINSIC
MyTH4	1826	1980	5.59e-48	SMART
B41	1983	2195	6.94e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000094135
AA Change: W2114L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091686
Gene: ENSMUSG00000042678
AA Change: W2114L

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
low complexity region	87	100	N/A	INTRINSIC
low complexity region	107	120	N/A	INTRINSIC
low complexity region	269	292	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
low complexity region	311	325	N/A	INTRINSIC
low complexity region	349	384	N/A	INTRINSIC
low complexity region	425	435	N/A	INTRINSIC
low complexity region	487	498	N/A	INTRINSIC
low complexity region	502	509	N/A	INTRINSIC
low complexity region	653	681	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
low complexity region	737	747	N/A	INTRINSIC
low complexity region	758	775	N/A	INTRINSIC
low complexity region	781	792	N/A	INTRINSIC
low complexity region	796	809	N/A	INTRINSIC
low complexity region	825	849	N/A	INTRINSIC
low complexity region	883	897	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
low complexity region	1115	1130	N/A	INTRINSIC
MYSc	1200	1884	N/A	SMART
IQ	1885	1907	1.63e-1	SMART
IQ	1908	1930	1.77e-2	SMART
IQ	1931	1953	2.97e2	SMART
low complexity region	1974	1988	N/A	INTRINSIC
MyTH4	2031	2177	1.8e-42	SMART
low complexity region	2378	2387	N/A	INTRINSIC
low complexity region	2433	2443	N/A	INTRINSIC
Blast:MYSc	2647	2830	2e-14	BLAST
SH3	2833	2915	1.55e-4	SMART
low complexity region	2931	2944	N/A	INTRINSIC
MyTH4	3013	3167	5.59e-48	SMART
B41	3170	3382	6.94e-3	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000120839
Gene: ENSMUSG00000042678
AA Change: W945L

Domain	Start	End	E-Value	Type
MYSc	34	716	N/A	SMART
IQ	717	739	1.63e-1	SMART
IQ	740	762	1.77e-2	SMART
IQ	763	785	2.97e2	SMART
low complexity region	806	820	N/A	INTRINSIC
MyTH4	863	1009	1.8e-42	SMART
low complexity region	1210	1219	N/A	INTRINSIC
low complexity region	1265	1275	N/A	INTRINSIC
Blast:MYSc	1479	1662	5e-15	BLAST
SH3	1665	1747	1.55e-4	SMART
low complexity region	1763	1776	N/A	INTRINSIC

Meta Mutation Damage Score

0.6807

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

98% (80/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an unconventional myosin. This protein differs from other myosins in that it has a long N-terminal extension preceding the conserved motor domain. Studies in mice suggest that this protein is necessary for actin organization in the hair cells of the cochlea. Mutations in this gene have been associated with profound, congenital, neurosensory, nonsyndromal deafness. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Read-through transcripts containing an upstream gene and this gene have been identified, but they are not thought to encode a fusion protein. Several alternatively spliced transcript variants have been described, but their full length sequences have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in profound deafness and neurological behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932443I19Rik	CA	CAA	8: 13,734,865		probably null	Het
Acads	A	T	5: 115,112,272	F198I	probably damaging	Het
Acy1	A	G	9: 106,437,627		probably null	Het
Adk	A	G	14: 21,076,308	M1V	probably null	Het
Ahi1	A	G	10: 20,963,691	D167G	probably benign	Het
Ankrd16	T	C	2: 11,786,243	V290A	possibly damaging	Het
Arhgef5	T	A	6: 43,274,417	S701T	possibly damaging	Het
Atp13a5	C	A	16: 29,281,951	M673I	probably damaging	Het
BC005624	T	C	2: 30,978,928	D78G	possibly damaging	Het
Bcat2	C	T	7: 45,589,321	H347Y	probably damaging	Het
Bpifb4	A	G	2: 153,942,627	Y85C	possibly damaging	Het
Cdc42	T	A	4: 137,322,621		probably null	Het
Cep170	G	A	1: 176,761,437	L541F	possibly damaging	Het
Cgrrf1	T	A	14: 46,853,722	N234K	probably benign	Het
Ctrc	C	T	4: 141,841,568	C108Y	probably damaging	Het
Cyp2u1	C	T	3: 131,298,296	V192M	possibly damaging	Het
Dhx38	A	T	8: 109,552,675	L1013Q	probably damaging	Het
Dnah1	T	A	14: 31,287,776	N1945I	probably damaging	Het
Dnah10	C	G	5: 124,821,450	N3765K	possibly damaging	Het
Dnah17	C	A	11: 118,060,079	R2906L	possibly damaging	Het
Dnajc10	C	T	2: 80,331,336	T306I	probably benign	Het
Efemp2	T	A	19: 5,480,245	C287S	probably damaging	Het
Efna1	T	C	3: 89,272,784	R143G	probably benign	Het
Emilin1	A	C	5: 30,917,077	N221H	probably damaging	Het
Epg5	A	G	18: 77,948,609	T174A	probably benign	Het
Fam184b	T	A	5: 45,532,901		probably null	Het
Fchsd2	T	A	7: 101,277,414	C570*	probably null	Het
Gm4787	A	T	12: 81,379,200	D61E	probably benign	Het
Gm7356	C	T	17: 14,001,663	G35R	probably damaging	Het
Gm8220	A	G	14: 44,288,188	T20A	probably damaging	Het
Hivep2	C	T	10: 14,128,501	T281M	probably damaging	Het
Ighv2-9-1	A	G	12: 113,770,072	V43A	probably damaging	Het
Klhl33	A	T	14: 50,891,916	C619S	probably benign	Het
Kmt2a	A	T	9: 44,829,261		probably benign	Het
Lax1	A	G	1: 133,680,158	C282R	probably benign	Het
Lrrd1	A	G	5: 3,851,395	K567E	probably benign	Het
Luzp1	C	T	4: 136,540,813	R116*	probably null	Het
Lypd3	G	C	7: 24,638,433	G75R	probably damaging	Het
Macrod2	A	T	2: 140,419,913	N38I	probably damaging	Het
Map3k14	A	T	11: 103,242,132	I80N	probably damaging	Het
Mcm9	A	G	10: 53,620,203	S368P	probably benign	Het
Mfge8	T	C	7: 79,143,301	D139G	probably benign	Het
Mmp19	A	T	10: 128,791,654	I54F	probably benign	Het
Myo1a	G	T	10: 127,710,458	V277L	probably benign	Het
Myoc	A	G	1: 162,639,346	D28G	probably damaging	Het
Myrf	G	T	19: 10,219,560	N487K	probably damaging	Het
Olfr1093	C	G	2: 86,786,155	L142V	probably damaging	Het
Olfr429	G	A	1: 174,089,750	A237T	probably damaging	Het
Olfr703	G	T	7: 106,844,802	G64*	probably null	Het
Omd	T	A	13: 49,590,234	F253L	probably damaging	Het
Papss1	T	G	3: 131,599,971	I238S	probably damaging	Het
Pkhd1	A	T	1: 20,562,451	F580Y	probably benign	Het
Polk	T	A	13: 96,516,681	K70N	probably damaging	Het
Ppig	T	A	2: 69,732,411	D31E	probably benign	Het
Ppp6r1	G	T	7: 4,633,292	S766R	possibly damaging	Het
Rab11fip5	T	C	6: 85,341,558	D783G	probably benign	Het
Reln	T	C	5: 21,985,857	I1511V	probably benign	Het
Rnh1	T	C	7: 141,163,183	N268S	probably damaging	Het
Rpia	A	G	6: 70,773,440	V236A	probably benign	Het
Rpl10a	G	T	17: 28,329,450	V80L	probably benign	Het
Sap130	T	G	18: 31,666,354	S295A	possibly damaging	Het
Sgms1	C	T	19: 32,142,793	V238I	probably benign	Het
Sh3tc1	A	G	5: 35,707,434	S470P	probably benign	Het
Slc25a32	A	G	15: 39,097,589	V233A	possibly damaging	Het
Slc2a2	T	C	3: 28,717,519	S158P	probably benign	Het
Slc6a2	A	G	8: 92,996,025	Y550C	probably benign	Het
Slc7a9	C	A	7: 35,452,511	T77K	probably benign	Het
Snd1	A	T	6: 28,626,101	D385V	probably benign	Het
Ssh3	A	T	19: 4,264,420	F369I	probably damaging	Het
Syk	A	G	13: 52,612,459		probably null	Het
Tbc1d16	A	G	11: 119,208,916	S211P	probably damaging	Het
Ttc3	A	G	16: 94,443,453	T1439A	probably benign	Het
Usp18	A	G	6: 121,252,514	M31V	probably benign	Het
Vav1	G	T	17: 57,302,330	E415D	possibly damaging	Het
Vps13a	A	T	19: 16,678,075	V1863D	probably benign	Het
Xdh	T	A	17: 73,922,562	I299F	probably damaging	Het
Zc3h14	A	G	12: 98,771,077		probably benign	Het
Zfp345	G	A	2: 150,473,411	H69Y	probably damaging	Het
Zfp652	G	T	11: 95,763,841	V357L	probably benign	Het
Zfp712	A	T	13: 67,040,827	Y545*	probably null	Het
Zgrf1	T	C	3: 127,559,632		probably null	Het

Other mutations in Myo15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00845:Myo15	APN	11	60477779	missense	probably damaging	1.00
IGL01011:Myo15	APN	11	60476992	missense	probably benign	0.33
IGL01100:Myo15	APN	11	60511158	missense	probably damaging	1.00
IGL01357:Myo15	APN	11	60502289	splice site	probably benign
IGL01634:Myo15	APN	11	60495472	missense	probably damaging	1.00
IGL01763:Myo15	APN	11	60521738	missense	probably benign	0.07
IGL01901:Myo15	APN	11	60527434	utr 3 prime	probably benign
IGL01931:Myo15	APN	11	60496138	missense	probably damaging	1.00
IGL02006:Myo15	APN	11	60511128	missense	probably damaging	1.00
IGL02041:Myo15	APN	11	60506863	missense	probably damaging	0.99
IGL02094:Myo15	APN	11	60510647	unclassified	probably benign
IGL02122:Myo15	APN	11	60483466	missense	probably benign	0.23
IGL02153:Myo15	APN	11	60498397	missense	probably damaging	1.00
IGL02328:Myo15	APN	11	60526607	missense	probably benign	0.13
IGL02330:Myo15	APN	11	60477161	missense	possibly damaging	0.94
IGL02431:Myo15	APN	11	60510639	missense	possibly damaging	0.73
IGL02639:Myo15	APN	11	60478621	missense	probably benign
IGL02659:Myo15	APN	11	60491783	splice site	probably benign
IGL02800:Myo15	APN	11	60502369	missense	probably damaging	1.00
IGL02812:Myo15	APN	11	60477179	missense	probably benign	0.15
IGL02863:Myo15	APN	11	60478127	missense	probably damaging	1.00
IGL02873:Myo15	APN	11	60483482	missense	probably damaging	1.00
IGL02990:Myo15	APN	11	60479440	missense	probably benign	0.02
IGL03011:Myo15	APN	11	60509531	splice site	probably benign
IGL03243:Myo15	APN	11	60496518	missense	probably damaging	1.00
IGL03297:Myo15	APN	11	60479141	missense	probably damaging	1.00
parker	UTSW	11	60520914	critical splice donor site	probably null
Typhoon	UTSW	11	60487425	critical splice donor site	probably null
PIT4131001:Myo15	UTSW	11	60483127	missense	probably damaging	1.00
PIT4131001:Myo15	UTSW	11	60495454	missense	probably damaging	1.00
R0133:Myo15	UTSW	11	60477850	missense	possibly damaging	0.94
R0265:Myo15	UTSW	11	60514897	critical splice acceptor site	probably null
R0389:Myo15	UTSW	11	60478538	missense	probably benign
R0416:Myo15	UTSW	11	60511174	missense	probably damaging	1.00
R0449:Myo15	UTSW	11	60509596	missense	possibly damaging	0.92
R0477:Myo15	UTSW	11	60520914	critical splice donor site	probably null
R0543:Myo15	UTSW	11	60479051	missense	probably benign
R0546:Myo15	UTSW	11	60506313	missense	probably damaging	1.00
R0555:Myo15	UTSW	11	60521638	missense	probably damaging	1.00
R0639:Myo15	UTSW	11	60479336	missense	probably benign	0.12
R0723:Myo15	UTSW	11	60478977	missense	possibly damaging	0.94
R0837:Myo15	UTSW	11	60487251	missense	probably damaging	0.98
R0865:Myo15	UTSW	11	60491688	missense	probably damaging	1.00
R0899:Myo15	UTSW	11	60477185	missense	possibly damaging	0.87
R1022:Myo15	UTSW	11	60479616	missense	probably benign	0.00
R1024:Myo15	UTSW	11	60479616	missense	probably benign	0.00
R1035:Myo15	UTSW	11	60510558	unclassified	probably benign
R1109:Myo15	UTSW	11	60493066	missense	probably damaging	1.00
R1170:Myo15	UTSW	11	60479407	missense	probably benign	0.04
R1241:Myo15	UTSW	11	60499430	missense	possibly damaging	0.58
R1392:Myo15	UTSW	11	60477974	missense	possibly damaging	0.95
R1392:Myo15	UTSW	11	60477974	missense	possibly damaging	0.95
R1434:Myo15	UTSW	11	60504331	missense	probably benign	0.00
R1450:Myo15	UTSW	11	60495482	missense	probably damaging	1.00
R1456:Myo15	UTSW	11	60508202	missense	probably damaging	1.00
R1468:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R1468:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R1548:Myo15	UTSW	11	60488238	missense	probably damaging	1.00
R1551:Myo15	UTSW	11	60492965	missense	possibly damaging	0.70
R1571:Myo15	UTSW	11	60518464	missense	probably damaging	1.00
R1662:Myo15	UTSW	11	60501701	missense	probably damaging	1.00
R1777:Myo15	UTSW	11	60514936	missense	probably benign
R1778:Myo15	UTSW	11	60478412	missense	possibly damaging	0.57
R1847:Myo15	UTSW	11	60499495	nonsense	probably null
R1875:Myo15	UTSW	11	60507528	missense	probably damaging	0.99
R1944:Myo15	UTSW	11	60502083	missense	probably damaging	0.99
R1945:Myo15	UTSW	11	60502083	missense	probably damaging	0.99
R2013:Myo15	UTSW	11	60494231	missense	probably damaging	1.00
R2107:Myo15	UTSW	11	60491810	missense	probably damaging	1.00
R2108:Myo15	UTSW	11	60491810	missense	probably damaging	1.00
R2112:Myo15	UTSW	11	60494168	missense	probably damaging	0.99
R2147:Myo15	UTSW	11	60510229	missense	possibly damaging	0.66
R2196:Myo15	UTSW	11	60510021	nonsense	probably null
R2207:Myo15	UTSW	11	60506034	missense	probably benign	0.01
R2245:Myo15	UTSW	11	60509099	missense	probably damaging	1.00
R2367:Myo15	UTSW	11	60517238	missense	probably damaging	0.99
R2374:Myo15	UTSW	11	60478843	missense	possibly damaging	0.88
R2438:Myo15	UTSW	11	60483052	missense	probably damaging	1.00
R3154:Myo15	UTSW	11	60479360	unclassified	probably null
R3423:Myo15	UTSW	11	60510300	critical splice donor site	probably null
R3551:Myo15	UTSW	11	60509663	missense	possibly damaging	0.93
R3552:Myo15	UTSW	11	60509663	missense	possibly damaging	0.93
R3612:Myo15	UTSW	11	60477679	missense	probably damaging	1.00
R3620:Myo15	UTSW	11	60478642	missense	possibly damaging	0.63
R3713:Myo15	UTSW	11	60479231	missense	possibly damaging	0.55
R3714:Myo15	UTSW	11	60479231	missense	possibly damaging	0.55
R3715:Myo15	UTSW	11	60479231	missense	possibly damaging	0.55
R3783:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3784:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3785:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3786:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3787:Myo15	UTSW	11	60477572	missense	probably damaging	0.97
R3894:Myo15	UTSW	11	60504319	missense	probably benign	0.00
R3962:Myo15	UTSW	11	60479828	missense	probably benign	0.00
R4082:Myo15	UTSW	11	60487196	missense	possibly damaging	0.92
R4555:Myo15	UTSW	11	60496937	missense	probably damaging	1.00
R4641:Myo15	UTSW	11	60503041	missense	probably damaging	1.00
R4665:Myo15	UTSW	11	60504879	critical splice acceptor site	probably null
R4713:Myo15	UTSW	11	60479930	missense	probably benign	0.21
R4820:Myo15	UTSW	11	60476915	missense	probably damaging	0.98
R5013:Myo15	UTSW	11	60491667	missense	probably damaging	1.00
R5051:Myo15	UTSW	11	60487425	critical splice donor site	probably null
R5187:Myo15	UTSW	11	60503614	missense	probably damaging	1.00
R5230:Myo15	UTSW	11	60502848	missense	possibly damaging	0.68
R5277:Myo15	UTSW	11	60477114	nonsense	probably null
R5345:Myo15	UTSW	11	60497538	missense	probably damaging	0.99
R5349:Myo15	UTSW	11	60493583	missense	probably damaging	1.00
R5356:Myo15	UTSW	11	60498366	missense	probably damaging	1.00
R5445:Myo15	UTSW	11	60520777	nonsense	probably null
R5477:Myo15	UTSW	11	60477677	missense	probably damaging	1.00
R5629:Myo15	UTSW	11	60479752	missense	probably benign
R5728:Myo15	UTSW	11	60488896	missense	probably damaging	1.00
R5818:Myo15	UTSW	11	60497951	missense	probably benign	0.06
R5952:Myo15	UTSW	11	60479420	missense	possibly damaging	0.50
R6338:Myo15	UTSW	11	60478133	missense	probably damaging	0.99
R6467:Myo15	UTSW	11	60526661	critical splice donor site	probably null
R6488:Myo15	UTSW	11	60478487	missense	possibly damaging	0.86
R6521:Myo15	UTSW	11	60502369	missense	probably damaging	1.00
R6645:Myo15	UTSW	11	60477292	missense	probably benign	0.00
R6702:Myo15	UTSW	11	60492992	missense	probably benign	0.16
R6703:Myo15	UTSW	11	60492992	missense	probably benign	0.16
R6821:Myo15	UTSW	11	60524475	missense	probably damaging	1.00
R6882:Myo15	UTSW	11	60524006	missense	probably damaging	1.00
R6908:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R6958:Myo15	UTSW	11	60503625	missense	probably benign	0.07
R7041:Myo15	UTSW	11	60506006	missense	probably damaging	1.00
R7149:Myo15	UTSW	11	60510010	missense	possibly damaging	0.56
R7163:Myo15	UTSW	11	60498369	missense
R7229:Myo15	UTSW	11	60496495	missense	probably benign	0.08
R7347:Myo15	UTSW	11	60477961	missense	probably benign
R7368:Myo15	UTSW	11	60490915	intron	probably null
R7392:Myo15	UTSW	11	60505976	missense
R7414:Myo15	UTSW	11	60483483	missense
R7461:Myo15	UTSW	11	60505152	missense
R7609:Myo15	UTSW	11	60488811	missense
R7613:Myo15	UTSW	11	60505152	missense
R7734:Myo15	UTSW	11	60510282	missense	probably benign
R7748:Myo15	UTSW	11	60504901	missense
R7767:Myo15	UTSW	11	60502096	missense
R7769:Myo15	UTSW	11	60509149	missense
X0021:Myo15	UTSW	11	60482359	nonsense	probably null
X0066:Myo15	UTSW	11	60478220	missense	probably damaging	1.00
X0067:Myo15	UTSW	11	60478618	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- CCTAGATCCTGCGTTTCATGGG -3'
(R):5'- TGTTGTAAAGCCTGCCACCG -3'

Sequencing Primer
(F):5'- GAGACCCCCACCTGCATG -3'
(R):5'- GACTCAGTTAAGTGACTGCAGTTC -3'

Posted On

2018-11-06