Incidental Mutation 'R6932:Zc3h14'
ID540117
Institutional Source Beutler Lab
Gene Symbol Zc3h14
Ensembl Gene ENSMUSG00000021012
Gene Namezinc finger CCCH type containing 14
Synonyms1700016A15Rik, 1010001P15Rik, 2700069A02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6932 (G1)
Quality Score153.008
Status Validated
Chromosome12
Chromosomal Location98746964-98787753 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 98771077 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000021399] [ENSMUST00000057000] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532]
Predicted Effect probably benign
Transcript: ENSMUST00000021399
SMART Domains Protein: ENSMUSP00000021399
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 69 91 N/A INTRINSIC
ZnF_C3H1 170 193 7.16e-1 SMART
ZnF_C3H1 195 214 5.27e1 SMART
ZnF_C3H1 250 272 5.55e0 SMART
Pfam:zf-CCCH_2 273 290 1.3e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057000
SMART Domains Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 440 463 7.16e-1 SMART
ZnF_C3H1 465 484 5.27e1 SMART
ZnF_C3H1 520 542 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110104
SMART Domains Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 465 488 7.16e-1 SMART
ZnF_C3H1 490 509 5.27e1 SMART
ZnF_C3H1 545 567 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110105
SMART Domains Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012

DomainStartEndE-ValueType
low complexity region 298 306 N/A INTRINSIC
low complexity region 313 320 N/A INTRINSIC
ZnF_C3H1 596 619 7.16e-1 SMART
ZnF_C3H1 621 640 5.27e1 SMART
ZnF_C3H1 676 698 5.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221532
Predicted Effect probably benign
Transcript: ENSMUST00000223451
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous knockout results in impaired spatial working memory, enlarged anterior lateral ventricles in the brain, small testes and reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik CA CAA 8: 13,734,865 probably null Het
Acads A T 5: 115,112,272 F198I probably damaging Het
Acy1 A G 9: 106,437,627 probably null Het
Adk A G 14: 21,076,308 M1V probably null Het
Ahi1 A G 10: 20,963,691 D167G probably benign Het
Ankrd16 T C 2: 11,786,243 V290A possibly damaging Het
Arhgef5 T A 6: 43,274,417 S701T possibly damaging Het
Atp13a5 C A 16: 29,281,951 M673I probably damaging Het
BC005624 T C 2: 30,978,928 D78G possibly damaging Het
Bcat2 C T 7: 45,589,321 H347Y probably damaging Het
Bpifb4 A G 2: 153,942,627 Y85C possibly damaging Het
Cdc42 T A 4: 137,322,621 probably null Het
Cep170 G A 1: 176,761,437 L541F possibly damaging Het
Cgrrf1 T A 14: 46,853,722 N234K probably benign Het
Ctrc C T 4: 141,841,568 C108Y probably damaging Het
Cyp2u1 C T 3: 131,298,296 V192M possibly damaging Het
Dhx38 A T 8: 109,552,675 L1013Q probably damaging Het
Dnah1 T A 14: 31,287,776 N1945I probably damaging Het
Dnah10 C G 5: 124,821,450 N3765K possibly damaging Het
Dnah17 C A 11: 118,060,079 R2906L possibly damaging Het
Dnajc10 C T 2: 80,331,336 T306I probably benign Het
Efemp2 T A 19: 5,480,245 C287S probably damaging Het
Efna1 T C 3: 89,272,784 R143G probably benign Het
Emilin1 A C 5: 30,917,077 N221H probably damaging Het
Epg5 A G 18: 77,948,609 T174A probably benign Het
Fam184b T A 5: 45,532,901 probably null Het
Fchsd2 T A 7: 101,277,414 C570* probably null Het
Gm4787 A T 12: 81,379,200 D61E probably benign Het
Gm7356 C T 17: 14,001,663 G35R probably damaging Het
Gm8220 A G 14: 44,288,188 T20A probably damaging Het
Hivep2 C T 10: 14,128,501 T281M probably damaging Het
Ighv2-9-1 A G 12: 113,770,072 V43A probably damaging Het
Klhl33 A T 14: 50,891,916 C619S probably benign Het
Kmt2a A T 9: 44,829,261 probably benign Het
Lax1 A G 1: 133,680,158 C282R probably benign Het
Lrrd1 A G 5: 3,851,395 K567E probably benign Het
Luzp1 C T 4: 136,540,813 R116* probably null Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Macrod2 A T 2: 140,419,913 N38I probably damaging Het
Map3k14 A T 11: 103,242,132 I80N probably damaging Het
Mcm9 A G 10: 53,620,203 S368P probably benign Het
Mfge8 T C 7: 79,143,301 D139G probably benign Het
Mmp19 A T 10: 128,791,654 I54F probably benign Het
Myo15 G T 11: 60,499,494 W2114L probably damaging Het
Myo1a G T 10: 127,710,458 V277L probably benign Het
Myoc A G 1: 162,639,346 D28G probably damaging Het
Myrf G T 19: 10,219,560 N487K probably damaging Het
Olfr1093 C G 2: 86,786,155 L142V probably damaging Het
Olfr429 G A 1: 174,089,750 A237T probably damaging Het
Olfr703 G T 7: 106,844,802 G64* probably null Het
Omd T A 13: 49,590,234 F253L probably damaging Het
Papss1 T G 3: 131,599,971 I238S probably damaging Het
Pkhd1 A T 1: 20,562,451 F580Y probably benign Het
Polk T A 13: 96,516,681 K70N probably damaging Het
Ppig T A 2: 69,732,411 D31E probably benign Het
Ppp6r1 G T 7: 4,633,292 S766R possibly damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Reln T C 5: 21,985,857 I1511V probably benign Het
Rnh1 T C 7: 141,163,183 N268S probably damaging Het
Rpia A G 6: 70,773,440 V236A probably benign Het
Rpl10a G T 17: 28,329,450 V80L probably benign Het
Sap130 T G 18: 31,666,354 S295A possibly damaging Het
Sgms1 C T 19: 32,142,793 V238I probably benign Het
Sh3tc1 A G 5: 35,707,434 S470P probably benign Het
Slc25a32 A G 15: 39,097,589 V233A possibly damaging Het
Slc2a2 T C 3: 28,717,519 S158P probably benign Het
Slc6a2 A G 8: 92,996,025 Y550C probably benign Het
Slc7a9 C A 7: 35,452,511 T77K probably benign Het
Snd1 A T 6: 28,626,101 D385V probably benign Het
Ssh3 A T 19: 4,264,420 F369I probably damaging Het
Syk A G 13: 52,612,459 probably null Het
Tbc1d16 A G 11: 119,208,916 S211P probably damaging Het
Ttc3 A G 16: 94,443,453 T1439A probably benign Het
Usp18 A G 6: 121,252,514 M31V probably benign Het
Vav1 G T 17: 57,302,330 E415D possibly damaging Het
Vps13a A T 19: 16,678,075 V1863D probably benign Het
Xdh T A 17: 73,922,562 I299F probably damaging Het
Zfp345 G A 2: 150,473,411 H69Y probably damaging Het
Zfp652 G T 11: 95,763,841 V357L probably benign Het
Zfp712 A T 13: 67,040,827 Y545* probably null Het
Zgrf1 T C 3: 127,559,632 probably null Het
Other mutations in Zc3h14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Zc3h14 APN 12 98747524 critical splice donor site probably null
IGL00946:Zc3h14 APN 12 98759883 splice site probably benign
IGL00969:Zc3h14 APN 12 98758843 missense probably benign 0.00
IGL01626:Zc3h14 APN 12 98779186 missense possibly damaging 0.72
IGL01891:Zc3h14 APN 12 98758947 unclassified probably benign
IGL02119:Zc3h14 APN 12 98763895 missense probably benign 0.00
IGL02484:Zc3h14 APN 12 98774301 missense probably benign 0.14
IGL02744:Zc3h14 APN 12 98784975 missense possibly damaging 0.67
IGL02894:Zc3h14 APN 12 98758943 critical splice donor site probably null
R0408:Zc3h14 UTSW 12 98763823 missense probably damaging 1.00
R0739:Zc3h14 UTSW 12 98757201 missense probably damaging 0.99
R0865:Zc3h14 UTSW 12 98779269 critical splice donor site probably null
R0926:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R1530:Zc3h14 UTSW 12 98785003 missense probably damaging 1.00
R1735:Zc3h14 UTSW 12 98758580 missense probably damaging 1.00
R1743:Zc3h14 UTSW 12 98779189 missense probably benign 0.04
R1848:Zc3h14 UTSW 12 98752832 missense possibly damaging 0.89
R1851:Zc3h14 UTSW 12 98760354 nonsense probably null
R1978:Zc3h14 UTSW 12 98763922 missense probably damaging 0.97
R2011:Zc3h14 UTSW 12 98780268 missense possibly damaging 0.76
R2198:Zc3h14 UTSW 12 98752809 missense probably damaging 1.00
R2198:Zc3h14 UTSW 12 98752810 missense possibly damaging 0.94
R2263:Zc3h14 UTSW 12 98758514 missense probably benign 0.32
R3762:Zc3h14 UTSW 12 98758643 missense probably damaging 1.00
R4210:Zc3h14 UTSW 12 98785399 missense probably damaging 1.00
R4353:Zc3h14 UTSW 12 98763960 missense possibly damaging 0.70
R4360:Zc3h14 UTSW 12 98780197 missense probably benign 0.09
R4814:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4815:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4817:Zc3h14 UTSW 12 98752848 missense probably damaging 1.00
R4947:Zc3h14 UTSW 12 98759824 missense probably benign
R5077:Zc3h14 UTSW 12 98757206 critical splice donor site probably null
R5431:Zc3h14 UTSW 12 98780065 missense possibly damaging 0.94
R5783:Zc3h14 UTSW 12 98757175 missense probably damaging 0.99
R5850:Zc3h14 UTSW 12 98779155 missense probably damaging 0.97
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6034:Zc3h14 UTSW 12 98771373 missense probably benign 0.01
R6291:Zc3h14 UTSW 12 98759828 missense probably damaging 1.00
R6338:Zc3h14 UTSW 12 98758590 missense possibly damaging 0.94
R6595:Zc3h14 UTSW 12 98757026 missense probably damaging 0.98
R6737:Zc3h14 UTSW 12 98785046 missense probably damaging 1.00
R7074:Zc3h14 UTSW 12 98758600 missense possibly damaging 0.96
R7204:Zc3h14 UTSW 12 98771356 missense probably damaging 1.00
R7237:Zc3h14 UTSW 12 98780149 missense probably benign 0.34
R7267:Zc3h14 UTSW 12 98785729 missense probably damaging 1.00
RF020:Zc3h14 UTSW 12 98780282 critical splice donor site probably null
RF024:Zc3h14 UTSW 12 98758861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAGTTGAGTGGACAATAGGGTG -3'
(R):5'- ACTGGCATTTTCACAGCCTG -3'

Sequencing Primer
(F):5'- GAATGGCTCTTCAGGATTCCCAAC -3'
(R):5'- TCACAGCCTGTTAAATTATCTCATC -3'
Posted On2018-11-06