Incidental Mutation 'R6932:Syk'
ID540120
Institutional Source Beutler Lab
Gene Symbol Syk
Ensembl Gene ENSMUSG00000021457
Gene Namespleen tyrosine kinase
SynonymsSykb
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6932 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location52583173-52648792 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 52612459 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055087] [ENSMUST00000118756] [ENSMUST00000120135]
PDB Structure
Solution structure of the Vav1 SH2 domain complexed with a Syk-derived doubly phosphorylated peptide [SOLUTION NMR]
Solution structure of the Vav1 SH2 domain complexed with a Syk-derived singly phosphorylated peptide [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000055087
SMART Domains Protein: ENSMUSP00000060828
Gene: ENSMUSG00000021457

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118756
SMART Domains Protein: ENSMUSP00000112914
Gene: ENSMUSG00000021457

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 342 582 2.68e-106 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120135
SMART Domains Protein: ENSMUSP00000113852
Gene: ENSMUSG00000021457

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice have high rates of postnatal lethality, exhibit developmental defects of B cells, T cells and osteoclasts, and have defective dendritic cell cross-presentation of antigens from necrotic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik CA CAA 8: 13,734,865 probably null Het
Acads A T 5: 115,112,272 F198I probably damaging Het
Acy1 A G 9: 106,437,627 probably null Het
Adk A G 14: 21,076,308 M1V probably null Het
Ahi1 A G 10: 20,963,691 D167G probably benign Het
Ankrd16 T C 2: 11,786,243 V290A possibly damaging Het
Arhgef5 T A 6: 43,274,417 S701T possibly damaging Het
Atp13a5 C A 16: 29,281,951 M673I probably damaging Het
BC005624 T C 2: 30,978,928 D78G possibly damaging Het
Bcat2 C T 7: 45,589,321 H347Y probably damaging Het
Bpifb4 A G 2: 153,942,627 Y85C possibly damaging Het
Cdc42 T A 4: 137,322,621 probably null Het
Cep170 G A 1: 176,761,437 L541F possibly damaging Het
Cgrrf1 T A 14: 46,853,722 N234K probably benign Het
Ctrc C T 4: 141,841,568 C108Y probably damaging Het
Cyp2u1 C T 3: 131,298,296 V192M possibly damaging Het
Dhx38 A T 8: 109,552,675 L1013Q probably damaging Het
Dnah1 T A 14: 31,287,776 N1945I probably damaging Het
Dnah10 C G 5: 124,821,450 N3765K possibly damaging Het
Dnah17 C A 11: 118,060,079 R2906L possibly damaging Het
Dnajc10 C T 2: 80,331,336 T306I probably benign Het
Efemp2 T A 19: 5,480,245 C287S probably damaging Het
Efna1 T C 3: 89,272,784 R143G probably benign Het
Emilin1 A C 5: 30,917,077 N221H probably damaging Het
Epg5 A G 18: 77,948,609 T174A probably benign Het
Fam184b T A 5: 45,532,901 probably null Het
Fchsd2 T A 7: 101,277,414 C570* probably null Het
Gm4787 A T 12: 81,379,200 D61E probably benign Het
Gm7356 C T 17: 14,001,663 G35R probably damaging Het
Gm8220 A G 14: 44,288,188 T20A probably damaging Het
Hivep2 C T 10: 14,128,501 T281M probably damaging Het
Ighv2-9-1 A G 12: 113,770,072 V43A probably damaging Het
Klhl33 A T 14: 50,891,916 C619S probably benign Het
Kmt2a A T 9: 44,829,261 probably benign Het
Lax1 A G 1: 133,680,158 C282R probably benign Het
Lrrd1 A G 5: 3,851,395 K567E probably benign Het
Luzp1 C T 4: 136,540,813 R116* probably null Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Macrod2 A T 2: 140,419,913 N38I probably damaging Het
Map3k14 A T 11: 103,242,132 I80N probably damaging Het
Mcm9 A G 10: 53,620,203 S368P probably benign Het
Mfge8 T C 7: 79,143,301 D139G probably benign Het
Mmp19 A T 10: 128,791,654 I54F probably benign Het
Myo15 G T 11: 60,499,494 W2114L probably damaging Het
Myo1a G T 10: 127,710,458 V277L probably benign Het
Myoc A G 1: 162,639,346 D28G probably damaging Het
Myrf G T 19: 10,219,560 N487K probably damaging Het
Olfr1093 C G 2: 86,786,155 L142V probably damaging Het
Olfr429 G A 1: 174,089,750 A237T probably damaging Het
Olfr703 G T 7: 106,844,802 G64* probably null Het
Omd T A 13: 49,590,234 F253L probably damaging Het
Papss1 T G 3: 131,599,971 I238S probably damaging Het
Pkhd1 A T 1: 20,562,451 F580Y probably benign Het
Polk T A 13: 96,516,681 K70N probably damaging Het
Ppig T A 2: 69,732,411 D31E probably benign Het
Ppp6r1 G T 7: 4,633,292 S766R possibly damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Reln T C 5: 21,985,857 I1511V probably benign Het
Rnh1 T C 7: 141,163,183 N268S probably damaging Het
Rpia A G 6: 70,773,440 V236A probably benign Het
Rpl10a G T 17: 28,329,450 V80L probably benign Het
Sap130 T G 18: 31,666,354 S295A possibly damaging Het
Sgms1 C T 19: 32,142,793 V238I probably benign Het
Sh3tc1 A G 5: 35,707,434 S470P probably benign Het
Slc25a32 A G 15: 39,097,589 V233A possibly damaging Het
Slc2a2 T C 3: 28,717,519 S158P probably benign Het
Slc6a2 A G 8: 92,996,025 Y550C probably benign Het
Slc7a9 C A 7: 35,452,511 T77K probably benign Het
Snd1 A T 6: 28,626,101 D385V probably benign Het
Ssh3 A T 19: 4,264,420 F369I probably damaging Het
Tbc1d16 A G 11: 119,208,916 S211P probably damaging Het
Ttc3 A G 16: 94,443,453 T1439A probably benign Het
Usp18 A G 6: 121,252,514 M31V probably benign Het
Vav1 G T 17: 57,302,330 E415D possibly damaging Het
Vps13a A T 19: 16,678,075 V1863D probably benign Het
Xdh T A 17: 73,922,562 I299F probably damaging Het
Zc3h14 A G 12: 98,771,077 probably benign Het
Zfp345 G A 2: 150,473,411 H69Y probably damaging Het
Zfp652 G T 11: 95,763,841 V357L probably benign Het
Zfp712 A T 13: 67,040,827 Y545* probably null Het
Zgrf1 T C 3: 127,559,632 probably null Het
Other mutations in Syk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Syk APN 13 52624748 missense probably benign 0.00
IGL01522:Syk APN 13 52643061 missense probably benign
IGL01957:Syk APN 13 52631740 missense probably benign
IGL01962:Syk APN 13 52610957 missense probably damaging 1.00
IGL02613:Syk APN 13 52643040 missense probably damaging 0.97
IGL02824:Syk APN 13 52623283 splice site probably benign
IGL03130:Syk APN 13 52622732 missense probably benign 0.12
Apricot UTSW 13 52640733 missense probably damaging 1.00
Poppy UTSW 13 52640733 missense probably damaging 1.00
Sisyphus UTSW 13 52640790 missense probably damaging 1.00
H8562:Syk UTSW 13 52640621 missense probably damaging 1.00
R0091:Syk UTSW 13 52640733 missense probably damaging 1.00
R0346:Syk UTSW 13 52640659 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1917:Syk UTSW 13 52622708 missense probably damaging 1.00
R2001:Syk UTSW 13 52611238 missense probably benign 0.21
R2919:Syk UTSW 13 52611121 missense probably benign
R3413:Syk UTSW 13 52631739 missense probably benign
R3695:Syk UTSW 13 52622765 splice site probably null
R4363:Syk UTSW 13 52640730 missense probably damaging 1.00
R4754:Syk UTSW 13 52612259 intron probably benign
R4755:Syk UTSW 13 52641986 missense probably benign 0.25
R4806:Syk UTSW 13 52632927 missense probably benign 0.14
R4817:Syk UTSW 13 52611206 missense probably benign 0.03
R4903:Syk UTSW 13 52611081 missense probably damaging 1.00
R4997:Syk UTSW 13 52612448 nonsense probably null
R5066:Syk UTSW 13 52641982 missense possibly damaging 0.49
R5114:Syk UTSW 13 52611035 missense probably damaging 1.00
R5267:Syk UTSW 13 52641926 missense probably benign 0.05
R5323:Syk UTSW 13 52631717 missense probably benign 0.00
R5705:Syk UTSW 13 52611047 missense probably benign 0.03
R6190:Syk UTSW 13 52611053 missense probably damaging 0.97
R6892:Syk UTSW 13 52632898 missense probably benign 0.00
R6977:Syk UTSW 13 52633058 missense probably benign 0.00
R7496:Syk UTSW 13 52612416 missense probably benign
R7650:Syk UTSW 13 52611095 missense probably benign 0.24
Z1177:Syk UTSW 13 52632913 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTGTTGATAGGACCTGGGAC -3'
(R):5'- ACGGTATCAATCTTTACGGGC -3'

Sequencing Primer
(F):5'- ACAGATGGGTCTAATGTCTTTCTACC -3'
(R):5'- ATCAATCTTTACGGGCAGGCTAG -3'
Posted On2018-11-06