Incidental Mutation 'R6932:Xdh'
ID 540134
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 045047-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.453) question?
Stock # R6932 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74229557 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 299 (I299F)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: I299F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: I299F

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.7346 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acads A T 5: 115,250,331 (GRCm39) F198I probably damaging Het
Acy1 A G 9: 106,314,826 (GRCm39) probably null Het
Adk A G 14: 21,126,376 (GRCm39) M1V probably null Het
Ahi1 A G 10: 20,839,590 (GRCm39) D167G probably benign Het
Ankrd16 T C 2: 11,791,054 (GRCm39) V290A possibly damaging Het
Arhgef5 T A 6: 43,251,351 (GRCm39) S701T possibly damaging Het
Atp13a5 C A 16: 29,100,769 (GRCm39) M673I probably damaging Het
BC005624 T C 2: 30,868,940 (GRCm39) D78G possibly damaging Het
Bcat2 C T 7: 45,238,745 (GRCm39) H347Y probably damaging Het
Bpifb4 A G 2: 153,784,547 (GRCm39) Y85C possibly damaging Het
Cdc42 T A 4: 137,049,932 (GRCm39) probably null Het
Cep170 G A 1: 176,589,003 (GRCm39) L541F possibly damaging Het
Cfap97d2 CA CAA 8: 13,784,865 (GRCm39) probably null Het
Cgrrf1 T A 14: 47,091,179 (GRCm39) N234K probably benign Het
Ctrc C T 4: 141,568,879 (GRCm39) C108Y probably damaging Het
Cyp2u1 C T 3: 131,091,945 (GRCm39) V192M possibly damaging Het
Dhx38 A T 8: 110,279,307 (GRCm39) L1013Q probably damaging Het
Dnah1 T A 14: 31,009,733 (GRCm39) N1945I probably damaging Het
Dnah10 C G 5: 124,898,514 (GRCm39) N3765K possibly damaging Het
Dnah17 C A 11: 117,950,905 (GRCm39) R2906L possibly damaging Het
Dnajc10 C T 2: 80,161,680 (GRCm39) T306I probably benign Het
Efemp2 T A 19: 5,530,273 (GRCm39) C287S probably damaging Het
Efna1 T C 3: 89,180,091 (GRCm39) R143G probably benign Het
Emilin1 A C 5: 31,074,421 (GRCm39) N221H probably damaging Het
Epg5 A G 18: 77,991,824 (GRCm39) T174A probably benign Het
Fam184b T A 5: 45,690,243 (GRCm39) probably null Het
Fchsd2 T A 7: 100,926,621 (GRCm39) C570* probably null Het
Gm4787 A T 12: 81,425,974 (GRCm39) D61E probably benign Het
Gm7356 C T 17: 14,221,925 (GRCm39) G35R probably damaging Het
Gm8220 A G 14: 44,525,645 (GRCm39) T20A probably damaging Het
Hivep2 C T 10: 14,004,245 (GRCm39) T281M probably damaging Het
Ighv2-9-1 A G 12: 113,733,692 (GRCm39) V43A probably damaging Het
Klhl33 A T 14: 51,129,373 (GRCm39) C619S probably benign Het
Kmt2a A T 9: 44,740,558 (GRCm39) probably benign Het
Lax1 A G 1: 133,607,896 (GRCm39) C282R probably benign Het
Lrrd1 A G 5: 3,901,395 (GRCm39) K567E probably benign Het
Luzp1 C T 4: 136,268,124 (GRCm39) R116* probably null Het
Lypd3 G C 7: 24,337,858 (GRCm39) G75R probably damaging Het
Macrod2 A T 2: 140,261,833 (GRCm39) N38I probably damaging Het
Map3k14 A T 11: 103,132,958 (GRCm39) I80N probably damaging Het
Mcm9 A G 10: 53,496,299 (GRCm39) S368P probably benign Het
Mfge8 T C 7: 78,793,049 (GRCm39) D139G probably benign Het
Mmp19 A T 10: 128,627,523 (GRCm39) I54F probably benign Het
Myo15a G T 11: 60,390,320 (GRCm39) W2114L probably damaging Het
Myo1a G T 10: 127,546,327 (GRCm39) V277L probably benign Het
Myoc A G 1: 162,466,915 (GRCm39) D28G probably damaging Het
Myrf G T 19: 10,196,924 (GRCm39) N487K probably damaging Het
Omd T A 13: 49,743,710 (GRCm39) F253L probably damaging Het
Or2ag19 G T 7: 106,444,009 (GRCm39) G64* probably null Het
Or5t5 C G 2: 86,616,499 (GRCm39) L142V probably damaging Het
Or6n1 G A 1: 173,917,316 (GRCm39) A237T probably damaging Het
Papss1 T G 3: 131,305,732 (GRCm39) I238S probably damaging Het
Pkhd1 A T 1: 20,632,675 (GRCm39) F580Y probably benign Het
Polk T A 13: 96,653,189 (GRCm39) K70N probably damaging Het
Ppig T A 2: 69,562,755 (GRCm39) D31E probably benign Het
Ppp6r1 G T 7: 4,636,291 (GRCm39) S766R possibly damaging Het
Rab11fip5 T C 6: 85,318,540 (GRCm39) D783G probably benign Het
Reln T C 5: 22,190,855 (GRCm39) I1511V probably benign Het
Rnh1 T C 7: 140,743,096 (GRCm39) N268S probably damaging Het
Rpia A G 6: 70,750,424 (GRCm39) V236A probably benign Het
Rpl10a G T 17: 28,548,424 (GRCm39) V80L probably benign Het
Sap130 T G 18: 31,799,407 (GRCm39) S295A possibly damaging Het
Sgms1 C T 19: 32,120,193 (GRCm39) V238I probably benign Het
Sh3tc1 A G 5: 35,864,778 (GRCm39) S470P probably benign Het
Slc25a32 A G 15: 38,960,984 (GRCm39) V233A possibly damaging Het
Slc2a2 T C 3: 28,771,668 (GRCm39) S158P probably benign Het
Slc6a2 A G 8: 93,722,653 (GRCm39) Y550C probably benign Het
Slc7a9 C A 7: 35,151,936 (GRCm39) T77K probably benign Het
Snd1 A T 6: 28,626,100 (GRCm39) D385V probably benign Het
Ssh3 A T 19: 4,314,448 (GRCm39) F369I probably damaging Het
Syk A G 13: 52,766,495 (GRCm39) probably null Het
Tbc1d16 A G 11: 119,099,742 (GRCm39) S211P probably damaging Het
Ttc3 A G 16: 94,244,312 (GRCm39) T1439A probably benign Het
Usp18 A G 6: 121,229,473 (GRCm39) M31V probably benign Het
Vav1 G T 17: 57,609,330 (GRCm39) E415D possibly damaging Het
Vps13a A T 19: 16,655,439 (GRCm39) V1863D probably benign Het
Zc3h14 A G 12: 98,737,336 (GRCm39) probably benign Het
Zfp345 G A 2: 150,315,331 (GRCm39) H69Y probably damaging Het
Zfp652 G T 11: 95,654,667 (GRCm39) V357L probably benign Het
Zfp712 A T 13: 67,188,891 (GRCm39) Y545* probably null Het
Zgrf1 T C 3: 127,353,281 (GRCm39) probably null Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATCTTCATGAAACTTCCC -3'
(R):5'- GGTATAGACATCGTCCCAGC -3'

Sequencing Primer
(F):5'- ACGAACCTGGGTTTGCATC -3'
(R):5'- GGTATAGACATCGTCCCAGCTCATG -3'
Posted On 2018-11-06