Incidental Mutation 'R6933:Sox11'
ID540174
Institutional Source Beutler Lab
Gene Symbol Sox11
Ensembl Gene ENSMUSG00000063632
Gene NameSRY (sex determining region Y)-box 11
Synonyms6230403H02Rik, 1110038H03Rik, end1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6933 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location27334264-27342574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 27341494 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 305 (S305R)
Ref Sequence ENSEMBL: ENSMUSP00000078070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079063]
Predicted Effect probably damaging
Transcript: ENSMUST00000079063
AA Change: S305R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078070
Gene: ENSMUSG00000063632
AA Change: S305R

DomainStartEndE-ValueType
HMG 48 118 1.35e-27 SMART
low complexity region 142 174 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
low complexity region 207 213 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 281 309 N/A INTRINSIC
low complexity region 344 357 N/A INTRINSIC
Meta Mutation Damage Score 0.0824 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.7%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may function in the developing nervous system and play a role in tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality with impaired ossification and impaired development of the heart, lung, spleen, stomach, skeleton and pancreas. Mice homozygous for a different knock-out allele exhibit abnormal nervous system development and complete neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik CA CAA 8: 13,734,865 probably null Het
Ank3 G T 10: 69,904,212 K814N probably damaging Het
Anks1b A G 10: 90,069,490 H231R probably damaging Het
Anks6 A G 4: 47,049,164 V247A probably benign Het
Antxrl A G 14: 34,075,771 N568D possibly damaging Het
Ccnl1 T C 3: 65,947,952 T366A probably benign Het
Ccr2 T G 9: 124,106,124 L147R probably damaging Het
Cdc40 A G 10: 40,844,996 V318A probably damaging Het
Cfap61 T A 2: 145,951,050 probably null Het
Clk3 A T 9: 57,761,849 Y31N probably damaging Het
Cmya5 T C 13: 93,095,136 Y1148C probably benign Het
Cntnap5b T C 1: 100,383,450 V927A probably benign Het
Dync1i1 A C 6: 5,913,333 T217P probably damaging Het
Elovl4 A G 9: 83,785,100 V68A probably damaging Het
Ep400 C A 5: 110,665,862 K2890N probably damaging Het
Fam114a2 T C 11: 57,484,071 I481V probably benign Het
Fam83e A G 7: 45,722,394 T72A probably benign Het
Fnip2 A T 3: 79,518,111 M59K probably benign Het
Lrpprc T C 17: 84,722,703 K1089R probably benign Het
Mndal T A 1: 173,875,683 E52V probably damaging Het
Myom1 C A 17: 71,052,671 T446K probably damaging Het
Nbea A T 3: 55,723,610 F2199I possibly damaging Het
Nr1h2 A T 7: 44,550,013 L438Q probably damaging Het
Olfr668 A G 7: 104,925,123 C214R probably benign Het
Pet117 T A 2: 144,369,099 V13E possibly damaging Het
Pnpla8 A G 12: 44,283,427 E254G probably benign Het
Polr2a T C 11: 69,736,177 E1485G probably damaging Het
Polr2a C T 11: 69,739,467 R1258Q probably benign Het
Ptpn4 T C 1: 119,773,148 probably benign Het
Rapgef2 A T 3: 79,085,959 Y889N probably damaging Het
Sbf1 G A 15: 89,300,369 R1115C probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Shank2 A T 7: 144,091,778 T366S probably benign Het
Slc22a23 T C 13: 34,305,180 I241V probably benign Het
Sox21 T C 14: 118,235,313 H108R possibly damaging Het
Taok1 A T 11: 77,555,653 S417T probably benign Het
Tg C T 15: 66,764,309 R582C possibly damaging Het
Traf3 T C 12: 111,255,224 V273A possibly damaging Het
Tspyl3 T C 2: 153,225,283 T12A probably benign Het
Vmn2r86 A T 10: 130,446,257 I830N probably damaging Het
Vps26b A T 9: 27,015,317 F129I possibly damaging Het
Washc3 A G 10: 88,201,852 N24S probably damaging Het
Xirp2 C A 2: 67,514,857 Q2481K probably benign Het
Zfhx4 T C 3: 5,412,987 V3554A probably damaging Het
Other mutations in Sox11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0898:Sox11 UTSW 12 27341225 missense probably damaging 1.00
R1265:Sox11 UTSW 12 27341736 missense probably benign 0.03
R2073:Sox11 UTSW 12 27342279 missense possibly damaging 0.91
R2108:Sox11 UTSW 12 27341703 missense probably damaging 1.00
R3620:Sox11 UTSW 12 27341736 missense probably benign 0.03
R3855:Sox11 UTSW 12 27341502 missense probably damaging 0.99
R5681:Sox11 UTSW 12 27341824 missense probably benign
R6288:Sox11 UTSW 12 27342333 missense possibly damaging 0.85
R7752:Sox11 UTSW 12 27341440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTCGGGGAACTCGAAGTG -3'
(R):5'- TTATCCCGACTACAAGTACCGG -3'

Sequencing Primer
(F):5'- CGGGGAACTCGAAGTGGGAAC -3'
(R):5'- TCTTCCTGGACGACGACGATG -3'
Posted On2018-11-06