Incidental Mutation 'R6933:Traf3'
ID540176
Institutional Source Beutler Lab
Gene Symbol Traf3
Ensembl Gene ENSMUSG00000021277
Gene NameTNF receptor-associated factor 3
SynonymsLAP1, CRAF1, CD40bp, CAP-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6933 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location111166370-111267153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111255224 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 273 (V273A)
Ref Sequence ENSEMBL: ENSMUSP00000021706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021706
AA Change: V273A

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: V273A

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060274
AA Change: V248A

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: V248A

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117269
AA Change: V248A

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: V248A

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Meta Mutation Damage Score 0.0840 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.7%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik CA CAA 8: 13,734,865 probably null Het
Ank3 G T 10: 69,904,212 K814N probably damaging Het
Anks1b A G 10: 90,069,490 H231R probably damaging Het
Anks6 A G 4: 47,049,164 V247A probably benign Het
Antxrl A G 14: 34,075,771 N568D possibly damaging Het
Ccnl1 T C 3: 65,947,952 T366A probably benign Het
Ccr2 T G 9: 124,106,124 L147R probably damaging Het
Cdc40 A G 10: 40,844,996 V318A probably damaging Het
Cfap61 T A 2: 145,951,050 probably null Het
Clk3 A T 9: 57,761,849 Y31N probably damaging Het
Cmya5 T C 13: 93,095,136 Y1148C probably benign Het
Cntnap5b T C 1: 100,383,450 V927A probably benign Het
Dync1i1 A C 6: 5,913,333 T217P probably damaging Het
Elovl4 A G 9: 83,785,100 V68A probably damaging Het
Ep400 C A 5: 110,665,862 K2890N probably damaging Het
Fam114a2 T C 11: 57,484,071 I481V probably benign Het
Fam83e A G 7: 45,722,394 T72A probably benign Het
Fnip2 A T 3: 79,518,111 M59K probably benign Het
Lrpprc T C 17: 84,722,703 K1089R probably benign Het
Mndal T A 1: 173,875,683 E52V probably damaging Het
Myom1 C A 17: 71,052,671 T446K probably damaging Het
Nbea A T 3: 55,723,610 F2199I possibly damaging Het
Nr1h2 A T 7: 44,550,013 L438Q probably damaging Het
Olfr668 A G 7: 104,925,123 C214R probably benign Het
Pet117 T A 2: 144,369,099 V13E possibly damaging Het
Pnpla8 A G 12: 44,283,427 E254G probably benign Het
Polr2a T C 11: 69,736,177 E1485G probably damaging Het
Polr2a C T 11: 69,739,467 R1258Q probably benign Het
Ptpn4 T C 1: 119,773,148 probably benign Het
Rapgef2 A T 3: 79,085,959 Y889N probably damaging Het
Sbf1 G A 15: 89,300,369 R1115C probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Shank2 A T 7: 144,091,778 T366S probably benign Het
Slc22a23 T C 13: 34,305,180 I241V probably benign Het
Sox11 G T 12: 27,341,494 S305R probably damaging Het
Sox21 T C 14: 118,235,313 H108R possibly damaging Het
Taok1 A T 11: 77,555,653 S417T probably benign Het
Tg C T 15: 66,764,309 R582C possibly damaging Het
Tspyl3 T C 2: 153,225,283 T12A probably benign Het
Vmn2r86 A T 10: 130,446,257 I830N probably damaging Het
Vps26b A T 9: 27,015,317 F129I possibly damaging Het
Washc3 A G 10: 88,201,852 N24S probably damaging Het
Xirp2 C A 2: 67,514,857 Q2481K probably benign Het
Zfhx4 T C 3: 5,412,987 V3554A probably damaging Het
Other mutations in Traf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense probably damaging 0.99
IGL02015:Traf3 APN 12 111252740 missense probably benign
IGL02318:Traf3 APN 12 111237597 missense probably benign
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.19
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.99
bananasplit UTSW 12 111262036 missense probably damaging 1.00
Han UTSW 12 111261576 missense probably damaging 1.00
Hulk UTSW 12 111261576 missense probably damaging 1.00
sundae UTSW 12 111255224 missense possibly damaging 0.80
R0023:Traf3 UTSW 12 111243478 nonsense probably null
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1507:Traf3 UTSW 12 111260760 missense probably benign 0.30
R1651:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.01
R1996:Traf3 UTSW 12 111260661 missense probably benign 0.21
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R3946:Traf3 UTSW 12 111255245 missense possibly damaging 0.91
R4477:Traf3 UTSW 12 111248602 missense probably benign 0.00
R4645:Traf3 UTSW 12 111261966 missense probably damaging 1.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
R5825:Traf3 UTSW 12 111255361 missense probably benign 0.03
R5912:Traf3 UTSW 12 111255349 missense probably benign 0.01
R6611:Traf3 UTSW 12 111237640 missense possibly damaging 0.76
R7389:Traf3 UTSW 12 111237753 missense probably damaging 1.00
R7425:Traf3 UTSW 12 111260661 nonsense probably null
R8512:Traf3 UTSW 12 111261992 missense probably benign 0.06
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Z1176:Traf3 UTSW 12 111261836 missense probably damaging 1.00
Z1177:Traf3 UTSW 12 111261492 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGAAATGGCTCACAGGGCTC -3'
(R):5'- AAGCTTCACCTGCTCCAGTG -3'

Sequencing Primer
(F):5'- AGGGCTCCCTGCTAGCTC -3'
(R):5'- TTCACCTGCTCCAGTGAGAGC -3'
Posted On2018-11-06