Mutagenetix > Incidental Mutations

Incidental Mutation 'R6934:Orc2'

540185

Institutional Source

Beutler Lab

Gene Symbol

Orc2

Ensembl Gene

ENSMUSG00000026037

Gene Name

origin recognition complex, subunit 2

Synonyms

Orc2l

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.955) question?

Stock #

R6934 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

58462771-58505109 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58500364 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 39 (K39E)

Ref Sequence

ENSEMBL: ENSMUSP00000141138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027198] [ENSMUST00000114325] [ENSMUST00000190695] [ENSMUST00000191206]

Predicted Effect

probably benign
Transcript: ENSMUST00000027198
AA Change: K39E

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000027198
Gene: ENSMUSG00000026037
AA Change: K39E

Domain	Start	End	E-Value	Type
low complexity region	176	201	N/A	INTRINSIC
Pfam:ORC2	254	563	2.5e-110	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114325

SMART Domains

Protein: ENSMUSP00000109964
Gene: ENSMUSG00000026037

Domain	Start	End	E-Value	Type
low complexity region	128	153	N/A	INTRINSIC
Pfam:ORC2	206	517	1.2e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000190695

Predicted Effect

probably benign
Transcript: ENSMUST00000191206
AA Change: K39E

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. This protein forms a core complex with ORC3, -4, and -5. It also interacts with CDC45 and MCM10, which are proteins known to be important for the initiation of DNA replication. This protein has been demonstrated to specifically associate with the origin of replication of Epstein-Barr virus in human cells, and is thought to be required for DNA replication from viral origin of replication. Alternatively spliced transcript variants have been found, one of which is a nonsense-mediated mRNA decay candidate. [provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018B08Rik	T	A	8: 121,539,973	Y58F	probably benign	Het
9530003J23Rik	C	T	10: 117,238,508	D25N	probably benign	Het
Asap2	T	C	12: 21,168,250	V58A	probably damaging	Het
BC067074	T	C	13: 113,369,266	S2310P	probably benign	Het
Bccip	A	G	7: 133,720,791	M289V	probably benign	Het
Bhmt2	A	T	13: 93,662,311	I334N	probably benign	Het
Copa	T	A	1: 172,110,686	I513N	possibly damaging	Het
Ctif	G	A	18: 75,435,360	T569M	probably benign	Het
Dennd1a	A	T	2: 37,801,213	M231K	possibly damaging	Het
Dnah3	A	G	7: 120,054,601		probably null	Het
Fat3	T	C	9: 16,376,956	I424V	probably damaging	Het
Foxred2	G	T	15: 77,952,330	C328*	probably null	Het
Gemin5	A	T	11: 58,147,912	H590Q	probably damaging	Het
Gm5475	T	C	15: 100,427,126		probably benign	Het
Gmip	A	G	8: 69,820,926	T956A	probably benign	Het
Hmbox1	A	T	14: 64,896,832	D106E	probably benign	Het
Irs2	A	T	8: 11,004,697	I1245N	probably damaging	Het
Kcnk1	A	G	8: 126,025,390	Y245C	probably damaging	Het
Krtap4-9	A	T	11: 99,785,882	R210*	probably null	Het
Lama1	A	G	17: 67,774,543	D1325G	probably benign	Het
Mep1a	A	T	17: 43,482,230	V361E	probably damaging	Het
Mrgprx2	A	G	7: 48,482,065	I92T	possibly damaging	Het
Nup214	A	T	2: 31,982,671	R242*	probably null	Het
Nynrin	T	G	14: 55,863,878	S335A	probably benign	Het
Olfr484	A	G	7: 108,124,819	V148A	probably benign	Het
Olfr538	T	G	7: 140,574,651	L166R	probably damaging	Het
Olfr905	T	G	9: 38,473,176	I143S	probably benign	Het
Ppl	C	T	16: 5,094,509	G736D	probably benign	Het
Ppp2r1a	A	G	17: 20,961,633	E471G	possibly damaging	Het
Prrc2c	G	A	1: 162,720,505	P161S	probably benign	Het
Rnf213	A	G	11: 119,420,067	I804V	probably benign	Het
Saal1	A	G	7: 46,702,664	C144R	probably benign	Het
Slc29a4	G	A	5: 142,712,958	V125I	probably benign	Het
Smarcc2	A	G	10: 128,469,672	T322A	probably benign	Het
Srgap2	A	T	1: 131,317,231	M591K	possibly damaging	Het
Stard9	A	G	2: 120,697,695	I1478V	probably benign	Het
Tet2	A	G	3: 133,483,237		probably null	Het
Tmem150c	C	T	5: 100,095,606		probably null	Het
Tmem39b	T	A	4: 129,678,573	H412L	possibly damaging	Het
Tox	A	C	4: 6,697,635	H389Q	probably damaging	Het
Trank1	T	C	9: 111,373,090	I1595T	probably damaging	Het
Vmn2r-ps117	T	G	17: 18,824,705	Y461*	probably null	Het
Vps13a	T	C	19: 16,676,194	H1941R	probably damaging	Het

Other mutations in Orc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Orc2	APN	1	58493716	missense	possibly damaging	0.81
IGL00549:Orc2	APN	1	58481042	missense	probably benign	0.00
IGL01343:Orc2	APN	1	58492855	critical splice donor site	probably null
IGL01357:Orc2	APN	1	58497392	missense	probably benign	0.26
IGL01357:Orc2	APN	1	58497393	missense	probably benign	0.00
IGL02167:Orc2	APN	1	58483639	unclassified	probably benign
IGL02343:Orc2	APN	1	58469666	critical splice donor site	probably null
IGL02548:Orc2	APN	1	58466122	unclassified	probably benign
R0557:Orc2	UTSW	1	58469687	missense	probably damaging	1.00
R1470:Orc2	UTSW	1	58481158	unclassified	probably benign
R1886:Orc2	UTSW	1	58471088	critical splice acceptor site	probably null
R2065:Orc2	UTSW	1	58469695	missense	probably damaging	1.00
R3848:Orc2	UTSW	1	58480992	missense	probably benign	0.08
R4389:Orc2	UTSW	1	58474861	missense	probably benign	0.21
R4393:Orc2	UTSW	1	58467650	critical splice donor site	probably null
R4613:Orc2	UTSW	1	58500309	nonsense	probably null
R5183:Orc2	UTSW	1	58474818	missense	possibly damaging	0.83
R5652:Orc2	UTSW	1	58466072	missense	probably damaging	0.99
R5793:Orc2	UTSW	1	58497388	start codon destroyed	probably null	0.27
R5997:Orc2	UTSW	1	58472388	missense	probably damaging	1.00
R6007:Orc2	UTSW	1	58467692	missense	probably benign	0.03
R6330:Orc2	UTSW	1	58500334	missense	probably benign
R6656:Orc2	UTSW	1	58493659	critical splice donor site	probably null
R6923:Orc2	UTSW	1	58500375	missense	probably benign	0.01
R7354:Orc2	UTSW	1	58469747	missense	possibly damaging	0.96
R7718:Orc2	UTSW	1	58480317	missense	possibly damaging	0.65
R7950:Orc2	UTSW	1	58467668	missense	possibly damaging	0.64
Z1088:Orc2	UTSW	1	58476516	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCACGTTACTAGCCGAAAGC -3'
(R):5'- ACTGACCCTGCGTTTAGTGTG -3'

Sequencing Primer
(F):5'- CGAAAGCTGGGTGTGTGTCAC -3'
(R):5'- CATGTAATATGCACATGGTGGTCAG -3'

Posted On

2018-11-06