Incidental Mutation 'R6934:Olfr538'
ID540202
Institutional Source Beutler Lab
Gene Symbol Olfr538
Ensembl Gene ENSMUSG00000095901
Gene Nameolfactory receptor 538
SynonymsMOR253-13P, MOR253-13P, GA_x6K02T2PBJ9-42723314-42724246, MOR253-10P, Olfr1553-ps1, MOR253-12P, Olfr1523-ps1, MOR253-12P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6934 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140567886-140575793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 140574651 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 166 (L166R)
Ref Sequence ENSEMBL: ENSMUSP00000147315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084457] [ENSMUST00000210973]
Predicted Effect probably damaging
Transcript: ENSMUST00000084457
AA Change: L166R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081495
Gene: ENSMUSG00000095901
AA Change: L166R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2.8e-6 PFAM
Pfam:7tm_1 41 290 2.5e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210973
AA Change: L166R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik T A 8: 121,539,973 Y58F probably benign Het
9530003J23Rik C T 10: 117,238,508 D25N probably benign Het
Asap2 T C 12: 21,168,250 V58A probably damaging Het
BC067074 T C 13: 113,369,266 S2310P probably benign Het
Bccip A G 7: 133,720,791 M289V probably benign Het
Bhmt2 A T 13: 93,662,311 I334N probably benign Het
Copa T A 1: 172,110,686 I513N possibly damaging Het
Ctif G A 18: 75,435,360 T569M probably benign Het
Dennd1a A T 2: 37,801,213 M231K possibly damaging Het
Dnah3 A G 7: 120,054,601 probably null Het
Fat3 T C 9: 16,376,956 I424V probably damaging Het
Foxred2 G T 15: 77,952,330 C328* probably null Het
Gemin5 A T 11: 58,147,912 H590Q probably damaging Het
Gm5475 T C 15: 100,427,126 probably benign Het
Gmip A G 8: 69,820,926 T956A probably benign Het
Hmbox1 A T 14: 64,896,832 D106E probably benign Het
Irs2 A T 8: 11,004,697 I1245N probably damaging Het
Kcnk1 A G 8: 126,025,390 Y245C probably damaging Het
Krtap4-9 A T 11: 99,785,882 R210* probably null Het
Lama1 A G 17: 67,774,543 D1325G probably benign Het
Mep1a A T 17: 43,482,230 V361E probably damaging Het
Mrgprx2 A G 7: 48,482,065 I92T possibly damaging Het
Nup214 A T 2: 31,982,671 R242* probably null Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr484 A G 7: 108,124,819 V148A probably benign Het
Olfr905 T G 9: 38,473,176 I143S probably benign Het
Orc2 T C 1: 58,500,364 K39E probably benign Het
Ppl C T 16: 5,094,509 G736D probably benign Het
Ppp2r1a A G 17: 20,961,633 E471G possibly damaging Het
Prrc2c G A 1: 162,720,505 P161S probably benign Het
Rnf213 A G 11: 119,420,067 I804V probably benign Het
Saal1 A G 7: 46,702,664 C144R probably benign Het
Slc29a4 G A 5: 142,712,958 V125I probably benign Het
Smarcc2 A G 10: 128,469,672 T322A probably benign Het
Srgap2 A T 1: 131,317,231 M591K possibly damaging Het
Stard9 A G 2: 120,697,695 I1478V probably benign Het
Tet2 A G 3: 133,483,237 probably null Het
Tmem150c C T 5: 100,095,606 probably null Het
Tmem39b T A 4: 129,678,573 H412L possibly damaging Het
Tox A C 4: 6,697,635 H389Q probably damaging Het
Trank1 T C 9: 111,373,090 I1595T probably damaging Het
Vmn2r-ps117 T G 17: 18,824,705 Y461* probably null Het
Vps13a T C 19: 16,676,194 H1941R probably damaging Het
Other mutations in Olfr538
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01894:Olfr538 APN 7 140574770 missense possibly damaging 0.93
IGL02066:Olfr538 APN 7 140574500 missense possibly damaging 0.55
IGL02214:Olfr538 APN 7 140574557 nonsense probably null
IGL02466:Olfr538 APN 7 140574771 missense probably benign 0.01
IGL02534:Olfr538 APN 7 140574641 missense probably benign 0.00
R0631:Olfr538 UTSW 7 140574507 missense probably damaging 1.00
R0989:Olfr538 UTSW 7 140574287 missense probably damaging 0.99
R1470:Olfr538 UTSW 7 140574749 missense probably benign 0.02
R1470:Olfr538 UTSW 7 140574749 missense probably benign 0.02
R1533:Olfr538 UTSW 7 140575121 unclassified probably null
R1764:Olfr538 UTSW 7 140574470 missense probably damaging 0.97
R2184:Olfr538 UTSW 7 140574402 missense probably benign
R2513:Olfr538 UTSW 7 140574156 start codon destroyed probably null 0.97
R4445:Olfr538 UTSW 7 140574389 missense probably damaging 1.00
R4476:Olfr538 UTSW 7 140574929 missense probably damaging 1.00
R4607:Olfr538 UTSW 7 140574641 missense probably benign 0.02
R4608:Olfr538 UTSW 7 140574641 missense probably benign 0.02
R4752:Olfr538 UTSW 7 140574602 missense possibly damaging 0.57
R6978:Olfr538 UTSW 7 140574287 missense probably damaging 0.99
R7559:Olfr538 UTSW 7 140574443 missense probably damaging 1.00
R7583:Olfr538 UTSW 7 140574210 missense probably benign 0.01
R7685:Olfr538 UTSW 7 140574246 missense probably damaging 1.00
Z1177:Olfr538 UTSW 7 140574956 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CTGGATCCTCTGAAGTGCTG -3'
(R):5'- GTAGAAAAGGCCTTCCTCTTGC -3'

Sequencing Primer
(F):5'- TGAAGTGCTGCTGCTCAC -3'
(R):5'- CCTCAGCAGAACGCATGTG -3'
Posted On2018-11-06