Incidental Mutation 'R6934:Kcnk1'
ID540206
Institutional Source Beutler Lab
Gene Symbol Kcnk1
Ensembl Gene ENSMUSG00000033998
Gene Namepotassium channel, subfamily K, member 1
SynonymsTWIK-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6934 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location125995170-126030685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126025390 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 245 (Y245C)
Ref Sequence ENSEMBL: ENSMUSP00000148778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046765] [ENSMUST00000212831]
Predicted Effect probably damaging
Transcript: ENSMUST00000046765
AA Change: Y245C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046103
Gene: ENSMUSG00000033998
AA Change: Y245C

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
low complexity region 49 68 N/A INTRINSIC
Pfam:Ion_trans_2 82 158 6.6e-19 PFAM
Pfam:Ion_trans_2 190 271 1.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212831
AA Change: Y245C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation reduced urinary flow rates and on a low phosphate diet display an attenuated ability to increase renal phosphate reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik T A 8: 121,539,973 Y58F probably benign Het
9530003J23Rik C T 10: 117,238,508 D25N probably benign Het
Asap2 T C 12: 21,168,250 V58A probably damaging Het
BC067074 T C 13: 113,369,266 S2310P probably benign Het
Bccip A G 7: 133,720,791 M289V probably benign Het
Bhmt2 A T 13: 93,662,311 I334N probably benign Het
Copa T A 1: 172,110,686 I513N possibly damaging Het
Ctif G A 18: 75,435,360 T569M probably benign Het
Dennd1a A T 2: 37,801,213 M231K possibly damaging Het
Dnah3 A G 7: 120,054,601 probably null Het
Fat3 T C 9: 16,376,956 I424V probably damaging Het
Foxred2 G T 15: 77,952,330 C328* probably null Het
Gemin5 A T 11: 58,147,912 H590Q probably damaging Het
Gm5475 T C 15: 100,427,126 probably benign Het
Gmip A G 8: 69,820,926 T956A probably benign Het
Hmbox1 A T 14: 64,896,832 D106E probably benign Het
Irs2 A T 8: 11,004,697 I1245N probably damaging Het
Krtap4-9 A T 11: 99,785,882 R210* probably null Het
Lama1 A G 17: 67,774,543 D1325G probably benign Het
Mep1a A T 17: 43,482,230 V361E probably damaging Het
Mrgprx2 A G 7: 48,482,065 I92T possibly damaging Het
Nup214 A T 2: 31,982,671 R242* probably null Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr484 A G 7: 108,124,819 V148A probably benign Het
Olfr538 T G 7: 140,574,651 L166R probably damaging Het
Olfr905 T G 9: 38,473,176 I143S probably benign Het
Orc2 T C 1: 58,500,364 K39E probably benign Het
Ppl C T 16: 5,094,509 G736D probably benign Het
Ppp2r1a A G 17: 20,961,633 E471G possibly damaging Het
Prrc2c G A 1: 162,720,505 P161S probably benign Het
Rnf213 A G 11: 119,420,067 I804V probably benign Het
Saal1 A G 7: 46,702,664 C144R probably benign Het
Slc29a4 G A 5: 142,712,958 V125I probably benign Het
Smarcc2 A G 10: 128,469,672 T322A probably benign Het
Srgap2 A T 1: 131,317,231 M591K possibly damaging Het
Stard9 A G 2: 120,697,695 I1478V probably benign Het
Tet2 A G 3: 133,483,237 probably null Het
Tmem150c C T 5: 100,095,606 probably null Het
Tmem39b T A 4: 129,678,573 H412L possibly damaging Het
Tox A C 4: 6,697,635 H389Q probably damaging Het
Trank1 T C 9: 111,373,090 I1595T probably damaging Het
Vmn2r-ps117 T G 17: 18,824,705 Y461* probably null Het
Vps13a T C 19: 16,676,194 H1941R probably damaging Het
Other mutations in Kcnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Kcnk1 APN 8 126025407 missense possibly damaging 0.94
IGL01936:Kcnk1 APN 8 126025087 missense probably damaging 1.00
IGL02447:Kcnk1 APN 8 126025080 missense probably damaging 1.00
IGL02674:Kcnk1 APN 8 126025014 missense probably damaging 1.00
PIT4515001:Kcnk1 UTSW 8 126025342 missense probably damaging 1.00
R0735:Kcnk1 UTSW 8 126025289 missense probably damaging 1.00
R1350:Kcnk1 UTSW 8 126025228 missense probably benign 0.08
R1581:Kcnk1 UTSW 8 125995539 missense possibly damaging 0.50
R1789:Kcnk1 UTSW 8 126025384 missense possibly damaging 0.83
R2035:Kcnk1 UTSW 8 126025369 missense possibly damaging 0.56
R2125:Kcnk1 UTSW 8 125995656 missense probably damaging 0.99
R2906:Kcnk1 UTSW 8 125995799 missense probably benign 0.00
R2907:Kcnk1 UTSW 8 125995799 missense probably benign 0.00
R4710:Kcnk1 UTSW 8 126029528 missense probably damaging 1.00
R5698:Kcnk1 UTSW 8 126025405 missense probably damaging 1.00
R6591:Kcnk1 UTSW 8 126025231 missense probably benign 0.01
R6647:Kcnk1 UTSW 8 125995460 start codon destroyed probably null 0.98
R6691:Kcnk1 UTSW 8 126025231 missense probably benign 0.01
R7059:Kcnk1 UTSW 8 126029727 nonsense probably null
R7082:Kcnk1 UTSW 8 125995548 missense probably damaging 1.00
R7441:Kcnk1 UTSW 8 125995568 missense probably damaging 1.00
R7596:Kcnk1 UTSW 8 125995611 missense probably damaging 0.97
Z1177:Kcnk1 UTSW 8 126029653 missense not run
Predicted Primers PCR Primer
(F):5'- TGGGATTTGTCACCGTTTCC -3'
(R):5'- ACACAGGAGTCACAGAGCATTG -3'

Sequencing Primer
(F):5'- GGATTTGTCACCGTTTCCTGCTTC -3'
(R):5'- GTCACAGAGCATTGGAAACATAAC -3'
Posted On2018-11-06