Incidental Mutation 'R6935:Bbc3'
ID540242
Institutional Source Beutler Lab
Gene Symbol Bbc3
Ensembl Gene ENSMUSG00000002083
Gene NameBCL2 binding component 3
SynonymsPUMA
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6935 (G1)
Quality Score105.008
Status Not validated
Chromosome7
Chromosomal Location16308393-16318205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16312199 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 20 (D20G)
Ref Sequence ENSEMBL: ENSMUSP00000147422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002152] [ENSMUST00000136781] [ENSMUST00000209688]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002152
AA Change: D20G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002152
Gene: ENSMUSG00000002083
AA Change: D20G

DomainStartEndE-ValueType
Pfam:PUMA 2 193 8.5e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136781
AA Change: D20G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119225
Gene: ENSMUSG00000002083
AA Change: D20G

DomainStartEndE-ValueType
low complexity region 42 71 N/A INTRINSIC
low complexity region 73 95 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209688
AA Change: D20G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the BCL-2 family of proteins. This family member belongs to the BH3-only pro-apoptotic subclass. The protein cooperates with direct activator proteins to induce mitochondrial outer membrane permeabilization and apoptosis. It can bind to anti-apoptotic Bcl-2 family members to induce mitochondrial dysfunction and caspase activation. Because of its pro-apoptotic role, this gene is a potential drug target for cancer therapy and for tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in apoptosis but otherwise are phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T A 14: 35,811,907 H14L probably benign Het
4932443I19Rik CA CAA 8: 13,734,865 probably null Het
Adar A G 3: 89,747,218 N368D probably benign Het
Adcy10 T C 1: 165,506,635 V71A probably benign Het
Ank1 C T 8: 23,108,231 T755I probably damaging Het
Aoc1 A T 6: 48,908,227 Y632F probably damaging Het
Bche T G 3: 73,701,800 I98L probably benign Het
Col12a1 A G 9: 79,700,500 Y349H possibly damaging Het
Crip2 T C 12: 113,140,593 C8R probably damaging Het
Dhx58 T A 11: 100,698,406 probably null Het
Dnah2 G A 11: 69,421,741 R4333C probably damaging Het
Dnajb12 T C 10: 59,896,503 probably null Het
Dzank1 T C 2: 144,476,094 E718G possibly damaging Het
Fbxo28 C T 1: 182,341,460 G38R unknown Het
Foxb2 A G 19: 16,872,619 F341S probably benign Het
Gabrb3 T A 7: 57,591,813 I29N probably damaging Het
Gm4881 C A 7: 24,928,561 G181V possibly damaging Het
Gm7298 G A 6: 121,767,694 R557H probably benign Het
Itih3 T A 14: 30,912,702 Q116L possibly damaging Het
Lingo1 T C 9: 56,619,865 Y480C probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mbd5 A G 2: 49,279,812 Y113C probably damaging Het
Mcm3ap C T 10: 76,504,253 P1453S possibly damaging Het
Mdn1 T G 4: 32,774,041 F5551V possibly damaging Het
Myo16 T A 8: 10,569,820 M1457K probably benign Het
Nbeal2 T A 9: 110,639,391 E372V probably damaging Het
Ncam2 T A 16: 81,526,991 S508T probably benign Het
Nebl A T 2: 17,348,826 D971E probably damaging Het
Nlrp10 A T 7: 108,926,900 M77K probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr1389 A G 11: 49,430,998 N174S probably damaging Het
Olfr600 A T 7: 103,346,795 N44K probably damaging Het
Olfr896-ps1 G T 9: 38,292,117 M57I probably benign Het
Pidd1 A T 7: 141,440,302 D570E probably damaging Het
Ppfia3 T C 7: 45,352,207 D427G possibly damaging Het
Prex1 T C 2: 166,599,655 Y364C probably damaging Het
Prlr A G 15: 10,319,302 S142G probably damaging Het
Rack1 T C 11: 48,803,495 V174A probably damaging Het
Rhbdl3 C T 11: 80,337,496 A264V probably damaging Het
Sh3bp5 T A 14: 31,379,516 M170L probably damaging Het
Skint5 A T 4: 113,942,596 F125L possibly damaging Het
Slc6a4 T C 11: 77,027,168 Y579H probably benign Het
Tmem106b A T 6: 13,081,555 T154S possibly damaging Het
Xrcc5 A G 1: 72,343,030 D455G possibly damaging Het
Other mutations in Bbc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
Dunnaway UTSW 7 16313808 nonsense probably null
R2130:Bbc3 UTSW 7 16312343 missense possibly damaging 0.51
R6669:Bbc3 UTSW 7 16313716 missense possibly damaging 0.84
R7159:Bbc3 UTSW 7 16313808 nonsense probably null
R7393:Bbc3 UTSW 7 16313789 missense probably benign 0.08
R7464:Bbc3 UTSW 7 16317157 missense unknown
R7575:Bbc3 UTSW 7 16312367 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTTGCTACAAACCCCAGACG -3'
(R):5'- TGGTTCTTGCTACACAAAGACC -3'

Sequencing Primer
(F):5'- TCACCATGTGTCCCGGC -3'
(R):5'- TTCTTGCTACACAAAGACCACACTG -3'
Posted On2018-11-06