Incidental Mutation 'R6936:Tbpl2'
ID540275
Institutional Source Beutler Lab
Gene Symbol Tbpl2
Ensembl Gene ENSMUSG00000061809
Gene NameTATA box binding protein like 2
SynonymsLOC227606, Trf3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R6936 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location24071721-24096595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24094941 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 64 (T64A)
Ref Sequence ENSEMBL: ENSMUSP00000120310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080453] [ENSMUST00000153338]
Predicted Effect probably benign
Transcript: ENSMUST00000080453
AA Change: T65A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000079309
Gene: ENSMUSG00000061809
AA Change: T65A

DomainStartEndE-ValueType
Pfam:TBP 173 255 1.2e-33 PFAM
Pfam:TBP 263 347 1.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153338
AA Change: T64A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000120310
Gene: ENSMUSG00000061809
AA Change: T64A

DomainStartEndE-ValueType
Pfam:TBP 171 255 3.1e-34 PFAM
Pfam:TBP 260 346 8.3e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.7%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele exhibit infertility due to impaired folliculogenesis before or during secondary follicle development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,568 I2772F probably damaging Het
Adam1a A G 5: 121,519,362 C623R probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ak4 C T 4: 101,447,259 A82V probably benign Het
Arhgap10 A T 8: 77,310,747 C617* probably null Het
Art1 A T 7: 102,106,770 D56V possibly damaging Het
Ascc3 A G 10: 50,729,961 D1392G probably damaging Het
Bbs5 T C 2: 69,654,354 S123P probably damaging Het
Cabin1 A T 10: 75,715,758 probably null Het
Carmil3 G A 14: 55,501,561 E891K probably benign Het
Cbfa2t3 C G 8: 122,647,739 R89P probably damaging Het
Ccdc157 A G 11: 4,144,030 S534P probably benign Het
Cep72 A T 13: 74,040,087 I229N probably damaging Het
Cnn3 C T 3: 121,450,053 probably benign Het
Cyp2c70 A G 19: 40,167,563 V181A probably damaging Het
Cyp2d26 C T 15: 82,792,540 D202N probably benign Het
Dbh A G 2: 27,172,797 K343E probably benign Het
Dlx5 A G 6: 6,879,585 Y161H probably damaging Het
Dnah5 A T 15: 28,409,268 I3611F probably damaging Het
Egf A C 3: 129,681,204 F563V possibly damaging Het
Enpp1 T C 10: 24,651,339 H650R probably benign Het
Exoc6 A G 19: 37,571,863 I109M probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgg C T 3: 83,008,420 S56F possibly damaging Het
Fras1 A G 5: 96,768,352 D3415G possibly damaging Het
Ghsr A G 3: 27,372,325 I177V probably benign Het
Gm1979 A T 5: 26,002,030 H62Q probably benign Het
Gpatch2 A G 1: 187,233,236 D313G probably benign Het
Gtf2i C T 5: 134,242,785 E823K probably damaging Het
Hook2 C A 8: 85,002,998 T689N probably benign Het
Hrnr A T 3: 93,332,360 N3302Y unknown Het
Igkv7-33 G A 6: 70,058,801 P66S possibly damaging Het
Kcnh2 T A 5: 24,324,339 I800F probably damaging Het
Mcmbp G A 7: 128,725,196 Q21* probably null Het
Mmp21 T C 7: 133,678,975 K89E probably benign Het
Olfr142 A G 2: 90,252,334 V218A probably benign Het
Olfr584 A T 7: 103,085,814 I94F probably damaging Het
Pcdhga4 A G 18: 37,687,405 D669G possibly damaging Het
Ralgapa1 T C 12: 55,786,212 T169A probably damaging Het
Sec31a T C 5: 100,392,510 N35S probably benign Het
Serpinb5 A T 1: 106,870,418 T46S probably benign Het
Svs2 A G 2: 164,237,628 S120P possibly damaging Het
Tecpr2 T A 12: 110,944,863 H1111Q possibly damaging Het
Tm9sf3 A G 19: 41,223,199 F402L probably benign Het
Tmem120b T G 5: 123,116,224 V287G possibly damaging Het
Tmem150c T C 5: 100,083,718 T133A possibly damaging Het
Ubqln3 A T 7: 104,142,310 V191D probably damaging Het
Ubr2 T C 17: 46,973,031 E564G possibly damaging Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Tbpl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Tbpl2 APN 2 24094973 missense probably benign 0.08
IGL02273:Tbpl2 APN 2 24096519 missense probably benign 0.00
IGL02887:Tbpl2 APN 2 24093876 missense probably damaging 0.99
IGL02969:Tbpl2 APN 2 24091093 missense probably damaging 1.00
IGL03075:Tbpl2 APN 2 24071985 utr 3 prime probably benign
IGL03107:Tbpl2 APN 2 24093833 missense probably benign 0.01
IGL03118:Tbpl2 APN 2 24087289 missense probably benign 0.22
R0322:Tbpl2 UTSW 2 24094979 missense probably benign 0.00
R1208:Tbpl2 UTSW 2 24094771 missense probably benign 0.02
R1208:Tbpl2 UTSW 2 24094771 missense probably benign 0.02
R1699:Tbpl2 UTSW 2 24095045 missense probably benign 0.00
R1987:Tbpl2 UTSW 2 24094732 missense probably benign
R2040:Tbpl2 UTSW 2 24094859 missense probably benign 0.00
R3500:Tbpl2 UTSW 2 24087139 missense probably benign 0.00
R3819:Tbpl2 UTSW 2 24076012 missense probably damaging 1.00
R3937:Tbpl2 UTSW 2 24087139 missense probably benign 0.00
R4995:Tbpl2 UTSW 2 24093860 missense possibly damaging 0.94
R5033:Tbpl2 UTSW 2 24087158 missense probably benign 0.01
R5606:Tbpl2 UTSW 2 24087233 missense possibly damaging 0.67
R6049:Tbpl2 UTSW 2 24094992 missense possibly damaging 0.75
R6153:Tbpl2 UTSW 2 24076016 missense probably damaging 1.00
R6260:Tbpl2 UTSW 2 24094886 missense possibly damaging 0.94
R6347:Tbpl2 UTSW 2 24094703 missense probably benign 0.35
R7378:Tbpl2 UTSW 2 24094700 missense probably benign 0.14
R7382:Tbpl2 UTSW 2 24087314 splice site probably null
R7958:Tbpl2 UTSW 2 24095067 splice site probably null
Predicted Primers PCR Primer
(F):5'- TTCAAGTTCAGCTCACTGCC -3'
(R):5'- ATCTTGGACCACCTTGTAGACTG -3'

Sequencing Primer
(F):5'- CATGTTCATCGGGCAACTGC -3'
(R):5'- ACCTTGTAGACTGAACCCATTG -3'
Posted On2018-11-06