Incidental Mutation 'R6936:Olfr142'
ID540278
Institutional Source Beutler Lab
Gene Symbol Olfr142
Ensembl Gene ENSMUSG00000075063
Gene Nameolfactory receptor 142
SynonymsGA_x6K02T2Q125-51607674-51606757, K20, MOR227-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6936 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location90250130-90257592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90252334 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 218 (V218A)
Ref Sequence ENSEMBL: ENSMUSP00000150216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099752] [ENSMUST00000213968]
Predicted Effect probably benign
Transcript: ENSMUST00000099752
AA Change: V218A

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097341
Gene: ENSMUSG00000075063
AA Change: V218A

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4.3e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 300 3e-6 PFAM
Pfam:7tm_1 39 285 5.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213968
AA Change: V218A

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,568 I2772F probably damaging Het
Adam1a A G 5: 121,519,362 C623R probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ak4 C T 4: 101,447,259 A82V probably benign Het
Arhgap10 A T 8: 77,310,747 C617* probably null Het
Art1 A T 7: 102,106,770 D56V possibly damaging Het
Ascc3 A G 10: 50,729,961 D1392G probably damaging Het
Bbs5 T C 2: 69,654,354 S123P probably damaging Het
Cabin1 A T 10: 75,715,758 probably null Het
Carmil3 G A 14: 55,501,561 E891K probably benign Het
Cbfa2t3 C G 8: 122,647,739 R89P probably damaging Het
Ccdc157 A G 11: 4,144,030 S534P probably benign Het
Cep72 A T 13: 74,040,087 I229N probably damaging Het
Cnn3 C T 3: 121,450,053 probably benign Het
Cyp2c70 A G 19: 40,167,563 V181A probably damaging Het
Cyp2d26 C T 15: 82,792,540 D202N probably benign Het
Dbh A G 2: 27,172,797 K343E probably benign Het
Dlx5 A G 6: 6,879,585 Y161H probably damaging Het
Dnah5 A T 15: 28,409,268 I3611F probably damaging Het
Egf A C 3: 129,681,204 F563V possibly damaging Het
Enpp1 T C 10: 24,651,339 H650R probably benign Het
Exoc6 A G 19: 37,571,863 I109M probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgg C T 3: 83,008,420 S56F possibly damaging Het
Fras1 A G 5: 96,768,352 D3415G possibly damaging Het
Ghsr A G 3: 27,372,325 I177V probably benign Het
Gm1979 A T 5: 26,002,030 H62Q probably benign Het
Gpatch2 A G 1: 187,233,236 D313G probably benign Het
Gtf2i C T 5: 134,242,785 E823K probably damaging Het
Hook2 C A 8: 85,002,998 T689N probably benign Het
Hrnr A T 3: 93,332,360 N3302Y unknown Het
Igkv7-33 G A 6: 70,058,801 P66S possibly damaging Het
Kcnh2 T A 5: 24,324,339 I800F probably damaging Het
Mcmbp G A 7: 128,725,196 Q21* probably null Het
Mmp21 T C 7: 133,678,975 K89E probably benign Het
Olfr584 A T 7: 103,085,814 I94F probably damaging Het
Pcdhga4 A G 18: 37,687,405 D669G possibly damaging Het
Ralgapa1 T C 12: 55,786,212 T169A probably damaging Het
Sec31a T C 5: 100,392,510 N35S probably benign Het
Serpinb5 A T 1: 106,870,418 T46S probably benign Het
Svs2 A G 2: 164,237,628 S120P possibly damaging Het
Tbpl2 T C 2: 24,094,941 T64A probably benign Het
Tecpr2 T A 12: 110,944,863 H1111Q possibly damaging Het
Tm9sf3 A G 19: 41,223,199 F402L probably benign Het
Tmem120b T G 5: 123,116,224 V287G possibly damaging Het
Tmem150c T C 5: 100,083,718 T133A possibly damaging Het
Ubqln3 A T 7: 104,142,310 V191D probably damaging Het
Ubr2 T C 17: 46,973,031 E564G possibly damaging Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Olfr142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Olfr142 APN 2 90252609 missense probably damaging 1.00
IGL01623:Olfr142 APN 2 90252609 missense probably damaging 1.00
IGL01810:Olfr142 APN 2 90252132 nonsense probably null
IGL01918:Olfr142 APN 2 90252331 missense probably damaging 1.00
IGL02619:Olfr142 APN 2 90252505 missense probably damaging 0.97
IGL02732:Olfr142 APN 2 90252308 missense probably damaging 1.00
IGL02738:Olfr142 APN 2 90252355 missense possibly damaging 0.82
IGL02795:Olfr142 APN 2 90252562 missense probably damaging 1.00
IGL02830:Olfr142 APN 2 90252781 missense probably damaging 1.00
R0601:Olfr142 UTSW 2 90252934 missense probably benign 0.05
R2004:Olfr142 UTSW 2 90252692 missense probably benign 0.04
R2136:Olfr142 UTSW 2 90252253 missense probably damaging 0.98
R2377:Olfr142 UTSW 2 90252911 missense probably damaging 1.00
R3615:Olfr142 UTSW 2 90252409 missense possibly damaging 0.94
R3616:Olfr142 UTSW 2 90252409 missense possibly damaging 0.94
R3777:Olfr142 UTSW 2 90252625 missense probably damaging 1.00
R4763:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R4765:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R5421:Olfr142 UTSW 2 90252745 missense probably benign 0.01
R5426:Olfr142 UTSW 2 90252611 nonsense probably null
R6063:Olfr142 UTSW 2 90252427 missense probably benign 0.40
R6717:Olfr142 UTSW 2 90252524 missense probably benign 0.00
R6931:Olfr142 UTSW 2 90252777 nonsense probably null
R7013:Olfr142 UTSW 2 90252097 missense possibly damaging 0.87
R7091:Olfr142 UTSW 2 90252463 missense probably damaging 1.00
R7247:Olfr142 UTSW 2 90252821 missense probably damaging 1.00
R8169:Olfr142 UTSW 2 90252098 nonsense probably null
R8345:Olfr142 UTSW 2 90252217 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CAATGGGGTTCAGCATAGGG -3'
(R):5'- TGAGTCGTCAAGTGTGTCAC -3'

Sequencing Primer
(F):5'- TTCAGCATAGGGGTAATGACAGTG -3'
(R):5'- CGTCAAGTGTGTCACATGCTG -3'
Posted On2018-11-06