Incidental Mutation 'R6936:Art1'
ID540299
Institutional Source Beutler Lab
Gene Symbol Art1
Ensembl Gene ENSMUSG00000030996
Gene NameADP-ribosyltransferase 1
SynonymsADPRT, Yac-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6936 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102101743-102113933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102106770 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 56 (D56V)
Ref Sequence ENSEMBL: ENSMUSP00000147911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033300] [ENSMUST00000084830] [ENSMUST00000094128] [ENSMUST00000209809] [ENSMUST00000210211]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033300
AA Change: D56V

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033300
Gene: ENSMUSG00000030996
AA Change: D56V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ART 39 269 2e-99 PFAM
low complexity region 288 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084830
SMART Domains Protein: ENSMUSP00000081891
Gene: ENSMUSG00000066279

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
Pfam:Neur_chan_LBD 30 236 1.5e-67 PFAM
Pfam:Neur_chan_memb 243 384 9.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094128
SMART Domains Protein: ENSMUSP00000091678
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 3.6e-96 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209809
AA Change: D56V

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000210211
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosyltransferase catalyzes the ADP-ribosylation of arginine residues in proteins. Mono-ADP-ribosylation is a posttranslational modification of proteins that is interfered with by a variety of bacterial toxins including cholera, pertussis, and heat-labile enterotoxins of E. coli. The amino acid sequence consists of predominantly hydrophobic N- and C-terminal regions, which is characteristic of glycosylphosphatidylinositol (GPI)-anchored proteins. This gene was previously designated ART2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,568 I2772F probably damaging Het
Adam1a A G 5: 121,519,362 C623R probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ak4 C T 4: 101,447,259 A82V probably benign Het
Arhgap10 A T 8: 77,310,747 C617* probably null Het
Ascc3 A G 10: 50,729,961 D1392G probably damaging Het
Bbs5 T C 2: 69,654,354 S123P probably damaging Het
Cabin1 A T 10: 75,715,758 probably null Het
Carmil3 G A 14: 55,501,561 E891K probably benign Het
Cbfa2t3 C G 8: 122,647,739 R89P probably damaging Het
Ccdc157 A G 11: 4,144,030 S534P probably benign Het
Cep72 A T 13: 74,040,087 I229N probably damaging Het
Cnn3 C T 3: 121,450,053 probably benign Het
Cyp2c70 A G 19: 40,167,563 V181A probably damaging Het
Cyp2d26 C T 15: 82,792,540 D202N probably benign Het
Dbh A G 2: 27,172,797 K343E probably benign Het
Dlx5 A G 6: 6,879,585 Y161H probably damaging Het
Dnah5 A T 15: 28,409,268 I3611F probably damaging Het
Egf A C 3: 129,681,204 F563V possibly damaging Het
Enpp1 T C 10: 24,651,339 H650R probably benign Het
Exoc6 A G 19: 37,571,863 I109M probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgg C T 3: 83,008,420 S56F possibly damaging Het
Fras1 A G 5: 96,768,352 D3415G possibly damaging Het
Ghsr A G 3: 27,372,325 I177V probably benign Het
Gm1979 A T 5: 26,002,030 H62Q probably benign Het
Gpatch2 A G 1: 187,233,236 D313G probably benign Het
Gtf2i C T 5: 134,242,785 E823K probably damaging Het
Hook2 C A 8: 85,002,998 T689N probably benign Het
Hrnr A T 3: 93,332,360 N3302Y unknown Het
Igkv7-33 G A 6: 70,058,801 P66S possibly damaging Het
Kcnh2 T A 5: 24,324,339 I800F probably damaging Het
Mcmbp G A 7: 128,725,196 Q21* probably null Het
Mmp21 T C 7: 133,678,975 K89E probably benign Het
Olfr142 A G 2: 90,252,334 V218A probably benign Het
Olfr584 A T 7: 103,085,814 I94F probably damaging Het
Pcdhga4 A G 18: 37,687,405 D669G possibly damaging Het
Ralgapa1 T C 12: 55,786,212 T169A probably damaging Het
Sec31a T C 5: 100,392,510 N35S probably benign Het
Serpinb5 A T 1: 106,870,418 T46S probably benign Het
Svs2 A G 2: 164,237,628 S120P possibly damaging Het
Tbpl2 T C 2: 24,094,941 T64A probably benign Het
Tecpr2 T A 12: 110,944,863 H1111Q possibly damaging Het
Tm9sf3 A G 19: 41,223,199 F402L probably benign Het
Tmem120b T G 5: 123,116,224 V287G possibly damaging Het
Tmem150c T C 5: 100,083,718 T133A possibly damaging Het
Ubqln3 A T 7: 104,142,310 V191D probably damaging Het
Ubr2 T C 17: 46,973,031 E564G possibly damaging Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Art1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02726:Art1 APN 7 102110748 missense probably damaging 0.97
IGL03238:Art1 APN 7 102110749 missense possibly damaging 0.46
R0885:Art1 UTSW 7 102107334 missense probably damaging 1.00
R1343:Art1 UTSW 7 102106953 missense probably damaging 1.00
R1348:Art1 UTSW 7 102107372 missense possibly damaging 0.55
R2167:Art1 UTSW 7 102106824 missense probably damaging 0.99
R4637:Art1 UTSW 7 102106337 missense probably damaging 0.96
R4821:Art1 UTSW 7 102107178 missense probably damaging 1.00
R5629:Art1 UTSW 7 102107079 missense probably benign 0.07
R6150:Art1 UTSW 7 102107087 missense probably benign
R7304:Art1 UTSW 7 102106324 missense possibly damaging 0.56
R8039:Art1 UTSW 7 102106845 missense probably benign 0.00
R8100:Art1 UTSW 7 102107198 missense probably damaging 1.00
R8183:Art1 UTSW 7 102107426 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCTCCAGATGTATTTGGGG -3'
(R):5'- GTTGAACTCCTTGTGCAGGG -3'

Sequencing Primer
(F):5'- CCAGATGTATTTGGGGGCCTTC -3'
(R):5'- CTCCTTGTGCAGGGGGCTG -3'
Posted On2018-11-06