Incidental Mutation 'R6936:Ubqln3'
ID540301
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Nameubiquilin 3
Synonyms4933400K24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R6936 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104140623-104143279 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104142310 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 191 (V191D)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: V191D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: V191D

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.8170 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,568 I2772F probably damaging Het
Adam1a A G 5: 121,519,362 C623R probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ak4 C T 4: 101,447,259 A82V probably benign Het
Arhgap10 A T 8: 77,310,747 C617* probably null Het
Art1 A T 7: 102,106,770 D56V possibly damaging Het
Ascc3 A G 10: 50,729,961 D1392G probably damaging Het
Bbs5 T C 2: 69,654,354 S123P probably damaging Het
Cabin1 A T 10: 75,715,758 probably null Het
Carmil3 G A 14: 55,501,561 E891K probably benign Het
Cbfa2t3 C G 8: 122,647,739 R89P probably damaging Het
Ccdc157 A G 11: 4,144,030 S534P probably benign Het
Cep72 A T 13: 74,040,087 I229N probably damaging Het
Cnn3 C T 3: 121,450,053 probably benign Het
Cyp2c70 A G 19: 40,167,563 V181A probably damaging Het
Cyp2d26 C T 15: 82,792,540 D202N probably benign Het
Dbh A G 2: 27,172,797 K343E probably benign Het
Dlx5 A G 6: 6,879,585 Y161H probably damaging Het
Dnah5 A T 15: 28,409,268 I3611F probably damaging Het
Egf A C 3: 129,681,204 F563V possibly damaging Het
Enpp1 T C 10: 24,651,339 H650R probably benign Het
Exoc6 A G 19: 37,571,863 I109M probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgg C T 3: 83,008,420 S56F possibly damaging Het
Fras1 A G 5: 96,768,352 D3415G possibly damaging Het
Ghsr A G 3: 27,372,325 I177V probably benign Het
Gm1979 A T 5: 26,002,030 H62Q probably benign Het
Gpatch2 A G 1: 187,233,236 D313G probably benign Het
Gtf2i C T 5: 134,242,785 E823K probably damaging Het
Hook2 C A 8: 85,002,998 T689N probably benign Het
Hrnr A T 3: 93,332,360 N3302Y unknown Het
Igkv7-33 G A 6: 70,058,801 P66S possibly damaging Het
Kcnh2 T A 5: 24,324,339 I800F probably damaging Het
Mcmbp G A 7: 128,725,196 Q21* probably null Het
Mmp21 T C 7: 133,678,975 K89E probably benign Het
Olfr142 A G 2: 90,252,334 V218A probably benign Het
Olfr584 A T 7: 103,085,814 I94F probably damaging Het
Pcdhga4 A G 18: 37,687,405 D669G possibly damaging Het
Ralgapa1 T C 12: 55,786,212 T169A probably damaging Het
Sec31a T C 5: 100,392,510 N35S probably benign Het
Serpinb5 A T 1: 106,870,418 T46S probably benign Het
Svs2 A G 2: 164,237,628 S120P possibly damaging Het
Tbpl2 T C 2: 24,094,941 T64A probably benign Het
Tecpr2 T A 12: 110,944,863 H1111Q possibly damaging Het
Tm9sf3 A G 19: 41,223,199 F402L probably benign Het
Tmem120b T G 5: 123,116,224 V287G possibly damaging Het
Tmem150c T C 5: 100,083,718 T133A possibly damaging Het
Ubr2 T C 17: 46,973,031 E564G possibly damaging Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 104141777 missense probably benign 0.00
IGL00766:Ubqln3 APN 7 104142824 missense probably benign 0.00
IGL01451:Ubqln3 APN 7 104142196 missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 104142398 missense probably benign 0.12
IGL01705:Ubqln3 APN 7 104142677 missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 104142882 utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 104142316 missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 104141299 missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 104142518 missense probably benign 0.02
IGL02657:Ubqln3 APN 7 104141963 missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 104142065 missense probably benign 0.19
IGL02709:Ubqln3 APN 7 104141336 missense probably benign 0.12
IGL03357:Ubqln3 APN 7 104142556 missense probably benign
PIT4544001:Ubqln3 UTSW 7 104141343 missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 104141840 missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 104142068 missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 104141386 missense probably benign 0.00
R1280:Ubqln3 UTSW 7 104142076 missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 104142790 missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 104141546 missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 104142860 missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 104141021 missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 104142151 missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 104142311 missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 104141635 nonsense probably null
R2366:Ubqln3 UTSW 7 104141049 missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 104141803 missense probably benign 0.00
R4447:Ubqln3 UTSW 7 104142814 missense probably benign 0.31
R4509:Ubqln3 UTSW 7 104141444 missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 104142491 missense probably benign 0.00
R5416:Ubqln3 UTSW 7 104141672 missense probably benign 0.34
R5617:Ubqln3 UTSW 7 104142433 missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 104140910 missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5723:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5724:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5819:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5820:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5966:Ubqln3 UTSW 7 104141699 missense probably benign 0.03
R6260:Ubqln3 UTSW 7 104142317 nonsense probably null
R6272:Ubqln3 UTSW 7 104142178 missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 104141617 missense probably benign 0.00
R7023:Ubqln3 UTSW 7 104141423 missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 104141275 missense probably benign 0.01
R7079:Ubqln3 UTSW 7 104141371 missense probably benign 0.12
R7733:Ubqln3 UTSW 7 104141076 missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 104141236 missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 104141192 missense probably benign 0.03
R7961:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
R8009:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
RF054:Ubqln3 UTSW 7 104141178 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGGATGCTCTCCAGGTTAC -3'
(R):5'- GGAGAAATCCCTCAGTCAAGTTC -3'

Sequencing Primer
(F):5'- AGGTTACTGAGTGCACGATCC -3'
(R):5'- AAATCCCTCAGTCAAGTTCTGTTTAC -3'
Posted On2018-11-06