Incidental Mutation 'R6936:Hook2'
ID540305
Institutional Source Beutler Lab
Gene Symbol Hook2
Ensembl Gene ENSMUSG00000052566
Gene Namehook microtubule tethering protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R6936 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84990603-85003349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85002998 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 689 (T689N)
Ref Sequence ENSEMBL: ENSMUSP00000148237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059072] [ENSMUST00000064495] [ENSMUST00000209322] [ENSMUST00000209421] [ENSMUST00000209764] [ENSMUST00000210326]
Predicted Effect probably benign
Transcript: ENSMUST00000059072
SMART Domains Protein: ENSMUSP00000053408
Gene: ENSMUSG00000052819

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 5.8e-118 PFAM
low complexity region 340 352 N/A INTRINSIC
low complexity region 408 417 N/A INTRINSIC
low complexity region 428 447 N/A INTRINSIC
low complexity region 457 479 N/A INTRINSIC
low complexity region 484 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064495
AA Change: T713N

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000067752
Gene: ENSMUSG00000052566
AA Change: T713N

DomainStartEndE-ValueType
Pfam:HOOK 8 703 2.3e-277 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209322
Predicted Effect probably benign
Transcript: ENSMUST00000209421
Predicted Effect probably benign
Transcript: ENSMUST00000209764
AA Change: T689N

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000210326
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hook proteins are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The Drosophila Hook protein is a component of the endocytic compartment.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,568 I2772F probably damaging Het
Adam1a A G 5: 121,519,362 C623R probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ak4 C T 4: 101,447,259 A82V probably benign Het
Arhgap10 A T 8: 77,310,747 C617* probably null Het
Art1 A T 7: 102,106,770 D56V possibly damaging Het
Ascc3 A G 10: 50,729,961 D1392G probably damaging Het
Bbs5 T C 2: 69,654,354 S123P probably damaging Het
Cabin1 A T 10: 75,715,758 probably null Het
Carmil3 G A 14: 55,501,561 E891K probably benign Het
Cbfa2t3 C G 8: 122,647,739 R89P probably damaging Het
Ccdc157 A G 11: 4,144,030 S534P probably benign Het
Cep72 A T 13: 74,040,087 I229N probably damaging Het
Cnn3 C T 3: 121,450,053 probably benign Het
Cyp2c70 A G 19: 40,167,563 V181A probably damaging Het
Cyp2d26 C T 15: 82,792,540 D202N probably benign Het
Dbh A G 2: 27,172,797 K343E probably benign Het
Dlx5 A G 6: 6,879,585 Y161H probably damaging Het
Dnah5 A T 15: 28,409,268 I3611F probably damaging Het
Egf A C 3: 129,681,204 F563V possibly damaging Het
Enpp1 T C 10: 24,651,339 H650R probably benign Het
Exoc6 A G 19: 37,571,863 I109M probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgg C T 3: 83,008,420 S56F possibly damaging Het
Fras1 A G 5: 96,768,352 D3415G possibly damaging Het
Ghsr A G 3: 27,372,325 I177V probably benign Het
Gm1979 A T 5: 26,002,030 H62Q probably benign Het
Gpatch2 A G 1: 187,233,236 D313G probably benign Het
Gtf2i C T 5: 134,242,785 E823K probably damaging Het
Hrnr A T 3: 93,332,360 N3302Y unknown Het
Igkv7-33 G A 6: 70,058,801 P66S possibly damaging Het
Kcnh2 T A 5: 24,324,339 I800F probably damaging Het
Mcmbp G A 7: 128,725,196 Q21* probably null Het
Mmp21 T C 7: 133,678,975 K89E probably benign Het
Olfr142 A G 2: 90,252,334 V218A probably benign Het
Olfr584 A T 7: 103,085,814 I94F probably damaging Het
Pcdhga4 A G 18: 37,687,405 D669G possibly damaging Het
Ralgapa1 T C 12: 55,786,212 T169A probably damaging Het
Sec31a T C 5: 100,392,510 N35S probably benign Het
Serpinb5 A T 1: 106,870,418 T46S probably benign Het
Svs2 A G 2: 164,237,628 S120P possibly damaging Het
Tbpl2 T C 2: 24,094,941 T64A probably benign Het
Tecpr2 T A 12: 110,944,863 H1111Q possibly damaging Het
Tm9sf3 A G 19: 41,223,199 F402L probably benign Het
Tmem120b T G 5: 123,116,224 V287G possibly damaging Het
Tmem150c T C 5: 100,083,718 T133A possibly damaging Het
Ubqln3 A T 7: 104,142,310 V191D probably damaging Het
Ubr2 T C 17: 46,973,031 E564G possibly damaging Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Hook2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Hook2 APN 8 85002497 unclassified probably benign
IGL01161:Hook2 APN 8 84994931 missense probably benign 0.05
IGL01535:Hook2 APN 8 85002989 missense probably benign 0.00
IGL01668:Hook2 APN 8 84993578 missense possibly damaging 0.88
IGL01749:Hook2 APN 8 84993236 critical splice donor site probably null
IGL01750:Hook2 APN 8 84993236 critical splice donor site probably null
IGL01753:Hook2 APN 8 84993236 critical splice donor site probably null
IGL01900:Hook2 APN 8 85001311 unclassified probably benign
IGL02157:Hook2 APN 8 85001150 unclassified probably benign
IGL02175:Hook2 APN 8 84991402 missense probably damaging 1.00
IGL02350:Hook2 APN 8 84994985 nonsense probably null
IGL02357:Hook2 APN 8 84994985 nonsense probably null
IGL03377:Hook2 APN 8 85001335 nonsense probably null
R0399:Hook2 UTSW 8 84993567 splice site probably benign
R1133:Hook2 UTSW 8 84995804 missense probably damaging 1.00
R2087:Hook2 UTSW 8 85002691 missense probably damaging 0.98
R2277:Hook2 UTSW 8 85002931 nonsense probably null
R2398:Hook2 UTSW 8 84991299 missense probably damaging 0.98
R3406:Hook2 UTSW 8 84993984 splice site probably benign
R4752:Hook2 UTSW 8 85002720 nonsense probably null
R5014:Hook2 UTSW 8 84991377 missense probably damaging 1.00
R5068:Hook2 UTSW 8 84993399 missense possibly damaging 0.81
R5195:Hook2 UTSW 8 84994776 missense probably damaging 1.00
R5360:Hook2 UTSW 8 85001404 missense probably damaging 1.00
R5597:Hook2 UTSW 8 84994028 missense probably benign 0.00
R5614:Hook2 UTSW 8 85002508 missense probably damaging 1.00
R5843:Hook2 UTSW 8 84991283 missense probably damaging 0.99
R5931:Hook2 UTSW 8 84995746 nonsense probably null
R5942:Hook2 UTSW 8 84994780 splice site probably null
R6120:Hook2 UTSW 8 84998125 missense probably damaging 1.00
R6167:Hook2 UTSW 8 84995013 missense probably damaging 1.00
R6992:Hook2 UTSW 8 85002556 missense probably damaging 1.00
R7058:Hook2 UTSW 8 84997411 missense possibly damaging 0.89
R7101:Hook2 UTSW 8 84997051 missense probably benign
R7177:Hook2 UTSW 8 84991417 missense probably benign 0.07
R8072:Hook2 UTSW 8 84994491 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCAGGTAGGCTCACTTACCC -3'
(R):5'- AGGCTCTTCCCAGGTAGTACAC -3'

Sequencing Primer
(F):5'- AGGCTCACTTACCCTGCTAATTATAC -3'
(R):5'- TTCCCAGGTAGTACACGAGGC -3'
Posted On2018-11-06