Incidental Mutation 'R6936:Ccdc157'
ID540310
Institutional Source Beutler Lab
Gene Symbol Ccdc157
Ensembl Gene ENSMUSG00000051427
Gene Namecoiled-coil domain containing 157
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6936 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location4141123-4160293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4144030 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 534 (S534P)
Ref Sequence ENSEMBL: ENSMUSP00000099148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003677] [ENSMUST00000093381] [ENSMUST00000101626]
Predicted Effect probably benign
Transcript: ENSMUST00000003677
SMART Domains Protein: ENSMUSP00000003677
Gene: ENSMUSG00000003581

DomainStartEndE-ValueType
signal peptide 1 45 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
low complexity region 149 162 N/A INTRINSIC
low complexity region 274 285 N/A INTRINSIC
RING 327 367 6.89e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093381
AA Change: S636P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091074
Gene: ENSMUSG00000051427
AA Change: S636P

DomainStartEndE-ValueType
low complexity region 76 88 N/A INTRINSIC
low complexity region 321 343 N/A INTRINSIC
low complexity region 385 414 N/A INTRINSIC
SCOP:d1fxkc_ 452 595 4e-5 SMART
low complexity region 639 659 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101626
AA Change: S534P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099148
Gene: ENSMUSG00000051427
AA Change: S534P

DomainStartEndE-ValueType
low complexity region 219 241 N/A INTRINSIC
low complexity region 283 312 N/A INTRINSIC
SCOP:d1fxkc_ 350 493 3e-4 SMART
low complexity region 537 557 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.7%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,568 I2772F probably damaging Het
Adam1a A G 5: 121,519,362 C623R probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ak4 C T 4: 101,447,259 A82V probably benign Het
Arhgap10 A T 8: 77,310,747 C617* probably null Het
Art1 A T 7: 102,106,770 D56V possibly damaging Het
Ascc3 A G 10: 50,729,961 D1392G probably damaging Het
Bbs5 T C 2: 69,654,354 S123P probably damaging Het
Cabin1 A T 10: 75,715,758 probably null Het
Carmil3 G A 14: 55,501,561 E891K probably benign Het
Cbfa2t3 C G 8: 122,647,739 R89P probably damaging Het
Cep72 A T 13: 74,040,087 I229N probably damaging Het
Cnn3 C T 3: 121,450,053 probably benign Het
Cyp2c70 A G 19: 40,167,563 V181A probably damaging Het
Cyp2d26 C T 15: 82,792,540 D202N probably benign Het
Dbh A G 2: 27,172,797 K343E probably benign Het
Dlx5 A G 6: 6,879,585 Y161H probably damaging Het
Dnah5 A T 15: 28,409,268 I3611F probably damaging Het
Egf A C 3: 129,681,204 F563V possibly damaging Het
Enpp1 T C 10: 24,651,339 H650R probably benign Het
Exoc6 A G 19: 37,571,863 I109M probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgg C T 3: 83,008,420 S56F possibly damaging Het
Fras1 A G 5: 96,768,352 D3415G possibly damaging Het
Ghsr A G 3: 27,372,325 I177V probably benign Het
Gm1979 A T 5: 26,002,030 H62Q probably benign Het
Gpatch2 A G 1: 187,233,236 D313G probably benign Het
Gtf2i C T 5: 134,242,785 E823K probably damaging Het
Hook2 C A 8: 85,002,998 T689N probably benign Het
Hrnr A T 3: 93,332,360 N3302Y unknown Het
Igkv7-33 G A 6: 70,058,801 P66S possibly damaging Het
Kcnh2 T A 5: 24,324,339 I800F probably damaging Het
Mcmbp G A 7: 128,725,196 Q21* probably null Het
Mmp21 T C 7: 133,678,975 K89E probably benign Het
Olfr142 A G 2: 90,252,334 V218A probably benign Het
Olfr584 A T 7: 103,085,814 I94F probably damaging Het
Pcdhga4 A G 18: 37,687,405 D669G possibly damaging Het
Ralgapa1 T C 12: 55,786,212 T169A probably damaging Het
Sec31a T C 5: 100,392,510 N35S probably benign Het
Serpinb5 A T 1: 106,870,418 T46S probably benign Het
Svs2 A G 2: 164,237,628 S120P possibly damaging Het
Tbpl2 T C 2: 24,094,941 T64A probably benign Het
Tecpr2 T A 12: 110,944,863 H1111Q possibly damaging Het
Tm9sf3 A G 19: 41,223,199 F402L probably benign Het
Tmem120b T G 5: 123,116,224 V287G possibly damaging Het
Tmem150c T C 5: 100,083,718 T133A possibly damaging Het
Ubqln3 A T 7: 104,142,310 V191D probably damaging Het
Ubr2 T C 17: 46,973,031 E564G possibly damaging Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Ccdc157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Ccdc157 APN 11 4148781 missense probably damaging 1.00
IGL02267:Ccdc157 APN 11 4144035 missense probably benign 0.00
IGL03182:Ccdc157 APN 11 4151832 missense probably damaging 1.00
R0282:Ccdc157 UTSW 11 4146708 missense probably damaging 0.98
R0360:Ccdc157 UTSW 11 4146663 missense probably damaging 0.98
R1349:Ccdc157 UTSW 11 4149056 missense probably benign 0.20
R1527:Ccdc157 UTSW 11 4151795 missense probably damaging 1.00
R1691:Ccdc157 UTSW 11 4149030 missense probably benign 0.07
R1932:Ccdc157 UTSW 11 4146549 missense probably damaging 1.00
R2132:Ccdc157 UTSW 11 4150004 missense probably damaging 1.00
R4361:Ccdc157 UTSW 11 4146550 missense probably damaging 0.99
R4754:Ccdc157 UTSW 11 4148994 missense possibly damaging 0.46
R4786:Ccdc157 UTSW 11 4151861 missense probably damaging 1.00
R5314:Ccdc157 UTSW 11 4150078 nonsense probably null
R5564:Ccdc157 UTSW 11 4148765 missense probably damaging 1.00
R5625:Ccdc157 UTSW 11 4151888 missense probably damaging 0.99
R5898:Ccdc157 UTSW 11 4144538 missense probably benign 0.23
R6193:Ccdc157 UTSW 11 4151912 missense probably damaging 1.00
R7057:Ccdc157 UTSW 11 4144586 missense probably benign 0.33
R7113:Ccdc157 UTSW 11 4148889 missense possibly damaging 0.94
R7136:Ccdc157 UTSW 11 4148592 missense possibly damaging 0.94
T0975:Ccdc157 UTSW 11 4146246 missense probably damaging 0.99
Z1177:Ccdc157 UTSW 11 4146547 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGATGCTGAATGACTTCCATCC -3'
(R):5'- AGCTTGGGATTCTGCCTCTC -3'

Sequencing Primer
(F):5'- TCCCCCAAAGAGAACTTGCTGG -3'
(R):5'- GCTTGGGATTCTGCCTCTCTATCTAC -3'
Posted On2018-11-06