Incidental Mutation 'R6936:Cyp2d26'
ID540317
Institutional Source Beutler Lab
Gene Symbol Cyp2d26
Ensembl Gene ENSMUSG00000022445
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 26
Synonyms1300006E06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6936 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82790101-82794294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82792540 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 202 (D202N)
Ref Sequence ENSEMBL: ENSMUSP00000006094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006094] [ENSMUST00000229387] [ENSMUST00000229512]
Predicted Effect probably benign
Transcript: ENSMUST00000006094
AA Change: D202N

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000006094
Gene: ENSMUSG00000022445
AA Change: D202N

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
Pfam:p450 37 497 3.5e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229387
Predicted Effect probably benign
Transcript: ENSMUST00000229512
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.7%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,568 I2772F probably damaging Het
Adam1a A G 5: 121,519,362 C623R probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ak4 C T 4: 101,447,259 A82V probably benign Het
Arhgap10 A T 8: 77,310,747 C617* probably null Het
Art1 A T 7: 102,106,770 D56V possibly damaging Het
Ascc3 A G 10: 50,729,961 D1392G probably damaging Het
Bbs5 T C 2: 69,654,354 S123P probably damaging Het
Cabin1 A T 10: 75,715,758 probably null Het
Carmil3 G A 14: 55,501,561 E891K probably benign Het
Cbfa2t3 C G 8: 122,647,739 R89P probably damaging Het
Ccdc157 A G 11: 4,144,030 S534P probably benign Het
Cep72 A T 13: 74,040,087 I229N probably damaging Het
Cnn3 C T 3: 121,450,053 probably benign Het
Cyp2c70 A G 19: 40,167,563 V181A probably damaging Het
Dbh A G 2: 27,172,797 K343E probably benign Het
Dlx5 A G 6: 6,879,585 Y161H probably damaging Het
Dnah5 A T 15: 28,409,268 I3611F probably damaging Het
Egf A C 3: 129,681,204 F563V possibly damaging Het
Enpp1 T C 10: 24,651,339 H650R probably benign Het
Exoc6 A G 19: 37,571,863 I109M probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgg C T 3: 83,008,420 S56F possibly damaging Het
Fras1 A G 5: 96,768,352 D3415G possibly damaging Het
Ghsr A G 3: 27,372,325 I177V probably benign Het
Gm1979 A T 5: 26,002,030 H62Q probably benign Het
Gpatch2 A G 1: 187,233,236 D313G probably benign Het
Gtf2i C T 5: 134,242,785 E823K probably damaging Het
Hook2 C A 8: 85,002,998 T689N probably benign Het
Hrnr A T 3: 93,332,360 N3302Y unknown Het
Igkv7-33 G A 6: 70,058,801 P66S possibly damaging Het
Kcnh2 T A 5: 24,324,339 I800F probably damaging Het
Mcmbp G A 7: 128,725,196 Q21* probably null Het
Mmp21 T C 7: 133,678,975 K89E probably benign Het
Olfr142 A G 2: 90,252,334 V218A probably benign Het
Olfr584 A T 7: 103,085,814 I94F probably damaging Het
Pcdhga4 A G 18: 37,687,405 D669G possibly damaging Het
Ralgapa1 T C 12: 55,786,212 T169A probably damaging Het
Sec31a T C 5: 100,392,510 N35S probably benign Het
Serpinb5 A T 1: 106,870,418 T46S probably benign Het
Svs2 A G 2: 164,237,628 S120P possibly damaging Het
Tbpl2 T C 2: 24,094,941 T64A probably benign Het
Tecpr2 T A 12: 110,944,863 H1111Q possibly damaging Het
Tm9sf3 A G 19: 41,223,199 F402L probably benign Het
Tmem120b T G 5: 123,116,224 V287G possibly damaging Het
Tmem150c T C 5: 100,083,718 T133A possibly damaging Het
Ubqln3 A T 7: 104,142,310 V191D probably damaging Het
Ubr2 T C 17: 46,973,031 E564G possibly damaging Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Cyp2d26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Cyp2d26 APN 15 82791043 missense probably benign 0.31
IGL00670:Cyp2d26 APN 15 82791741 missense probably benign
IGL01646:Cyp2d26 APN 15 82791418 missense probably benign 0.00
IGL01915:Cyp2d26 APN 15 82790249 missense probably benign 0.06
IGL01940:Cyp2d26 APN 15 82792557 missense probably benign 0.00
IGL02127:Cyp2d26 APN 15 82791106 missense probably benign 0.09
IGL02452:Cyp2d26 APN 15 82792626 missense probably benign 0.00
IGL03216:Cyp2d26 APN 15 82793261 missense probably benign
IGL03377:Cyp2d26 APN 15 82790554 missense possibly damaging 0.47
R0149:Cyp2d26 UTSW 15 82792767 missense probably damaging 1.00
R0848:Cyp2d26 UTSW 15 82790233 missense probably benign 0.00
R1165:Cyp2d26 UTSW 15 82794041 missense probably damaging 1.00
R1217:Cyp2d26 UTSW 15 82792867 splice site probably benign
R1780:Cyp2d26 UTSW 15 82794007 missense probably damaging 1.00
R2048:Cyp2d26 UTSW 15 82792727 utr 3 prime probably benign
R2152:Cyp2d26 UTSW 15 82792706 critical splice donor site probably null
R2397:Cyp2d26 UTSW 15 82794035 missense probably damaging 1.00
R4702:Cyp2d26 UTSW 15 82792447 intron probably benign
R5157:Cyp2d26 UTSW 15 82790989 missense probably benign 0.01
R5444:Cyp2d26 UTSW 15 82792538 missense probably benign 0.18
R6017:Cyp2d26 UTSW 15 82790573 missense possibly damaging 0.68
R6223:Cyp2d26 UTSW 15 82791717 missense probably benign 0.04
R6390:Cyp2d26 UTSW 15 82792624 missense possibly damaging 0.68
R6473:Cyp2d26 UTSW 15 82791767 missense probably benign 0.02
R6858:Cyp2d26 UTSW 15 82794083 missense probably damaging 1.00
R6912:Cyp2d26 UTSW 15 82791119 missense probably benign 0.16
R6960:Cyp2d26 UTSW 15 82790245 missense probably damaging 0.98
R7053:Cyp2d26 UTSW 15 82792600 missense probably benign 0.00
R7113:Cyp2d26 UTSW 15 82790202 missense probably benign 0.02
R7126:Cyp2d26 UTSW 15 82794008 missense probably benign 0.00
R7272:Cyp2d26 UTSW 15 82792563 missense probably benign
R7771:Cyp2d26 UTSW 15 82791746 missense probably benign
R8695:Cyp2d26 UTSW 15 82792706 critical splice donor site probably benign
X0021:Cyp2d26 UTSW 15 82790517 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAGGTTTGTCAACACCCAAG -3'
(R):5'- TCTGCGATGCTTTCACCAAG -3'

Sequencing Primer
(F):5'- GGTTTGTCAACACCCAAGCCTTTC -3'
(R):5'- ATGCTTTCACCAAGGAGGC -3'
Posted On2018-11-06