Incidental Mutation 'R6937:Lcn3'
ID540326
Institutional Source Beutler Lab
Gene Symbol Lcn3
Ensembl Gene ENSMUSG00000026936
Gene Namelipocalin 3
SynonymsVnsp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6937 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25765569-25768099 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 25767811 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 179 (Y179*)
Ref Sequence ENSEMBL: ENSMUSP00000028304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028304]
Predicted Effect probably null
Transcript: ENSMUST00000028304
AA Change: Y179*
SMART Domains Protein: ENSMUSP00000028304
Gene: ENSMUSG00000026936
AA Change: Y179*

DomainStartEndE-ValueType
Pfam:Lipocalin 37 171 2.5e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,387,020 V613A probably benign Het
Cdh23 A T 10: 60,487,114 L337Q probably damaging Het
Chrna6 A G 8: 27,407,027 L274P probably damaging Het
Ciita G A 16: 10,512,491 probably null Het
Csnka2ip A T 16: 64,478,695 probably benign Het
Ddx60 G A 8: 62,037,069 D1691N probably damaging Het
Dnah7b T C 1: 46,195,120 I1441T probably damaging Het
Dock4 T C 12: 40,834,635 S1713P probably benign Het
Ep400 T C 5: 110,711,152 probably benign Het
Epn1 T C 7: 5,089,944 I85T probably damaging Het
Eri2 T C 7: 119,786,789 K228E probably damaging Het
Garem1 C T 18: 21,147,770 A510T probably benign Het
Gfm2 T A 13: 97,163,064 probably null Het
Gm37596 T C 3: 93,692,216 N282S probably benign Het
Gm4858 A G 3: 93,074,110 H145R probably benign Het
Hnrnpd T C 5: 99,963,770 T321A probably benign Het
Htr2a A T 14: 74,645,164 I197F probably damaging Het
Krtap2-4 T A 11: 99,614,473 probably benign Het
Mak A T 13: 41,048,102 M261K probably damaging Het
March7 A G 2: 60,240,966 T605A probably damaging Het
Mcm4 A C 16: 15,636,335 F83V probably benign Het
Myo18b T C 5: 112,802,392 N1546S probably benign Het
Nckap1 T A 2: 80,508,716 K989N probably damaging Het
Ndufaf5 A G 2: 140,181,602 D119G probably damaging Het
Olfr846 A T 9: 19,360,689 V222D probably damaging Het
Pcdh1 T C 18: 38,203,475 T36A possibly damaging Het
Pitpna C T 11: 75,603,731 T100I possibly damaging Het
Pmf1 A T 3: 88,399,189 L102Q probably damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Robo3 A G 9: 37,429,880 L10P probably benign Het
Serpinb6a T C 13: 33,918,818 I241V possibly damaging Het
St14 A T 9: 31,129,660 probably null Het
Stat6 T C 10: 127,658,702 probably null Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tgfbrap1 A T 1: 43,051,904 V687E probably damaging Het
Trim30d A T 7: 104,483,427 S68T probably damaging Het
Ttn A G 2: 76,832,909 probably benign Het
Ugt3a1 A T 15: 9,292,072 D97V probably benign Het
Ugt8a G A 3: 125,915,601 probably benign Het
Vmn1r184 A T 7: 26,267,325 K165N probably benign Het
Vmn2r86 T A 10: 130,448,654 I523F probably damaging Het
Wapl G A 14: 34,722,354 V588I probably benign Het
Wdr7 C T 18: 63,791,867 P974S probably benign Het
Zfp975 T C 7: 42,665,056 D31G possibly damaging Het
Other mutations in Lcn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Lcn3 APN 2 25765624 missense probably benign 0.27
IGL02139:Lcn3 APN 2 25766634 missense possibly damaging 0.66
IGL02221:Lcn3 APN 2 25766160 missense probably benign 0.01
IGL02665:Lcn3 APN 2 25766404 missense possibly damaging 0.66
IGL03049:Lcn3 APN 2 25765574 start codon destroyed probably null 0.02
R0552:Lcn3 UTSW 2 25766409 critical splice donor site probably null
R3522:Lcn3 UTSW 2 25766121 missense possibly damaging 0.56
R4227:Lcn3 UTSW 2 25766111 missense probably benign 0.00
R6684:Lcn3 UTSW 2 25766158 missense probably benign 0.00
R7010:Lcn3 UTSW 2 25766056 missense probably damaging 0.99
R7487:Lcn3 UTSW 2 25766162 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGAGAACATATGCAACCCATG -3'
(R):5'- ATCCAGCAGGCCACTCTTTC -3'

Sequencing Primer
(F):5'- ATATGCAACCCATGTCCCCCTC -3'
(R):5'- TGGCGGCACTCACTCACTTG -3'
Posted On2018-11-06