Incidental Mutation 'R6937:Hnrnpd'
ID540335
Institutional Source Beutler Lab
Gene Symbol Hnrnpd
Ensembl Gene ENSMUSG00000000568
Gene Nameheterogeneous nuclear ribonucleoprotein D
SynonymsAuf1, Hnrpd
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.742) question?
Stock #R6937 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location99955935-99978938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99963770 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 321 (T321A)
Ref Sequence ENSEMBL: ENSMUSP00000132735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019128] [ENSMUST00000072750] [ENSMUST00000112939] [ENSMUST00000164833] [ENSMUST00000168396] [ENSMUST00000170912] [ENSMUST00000171640] [ENSMUST00000171786] [ENSMUST00000172361]
Predicted Effect probably benign
Transcript: ENSMUST00000019128
SMART Domains Protein: ENSMUSP00000019128
Gene: ENSMUSG00000000568

DomainStartEndE-ValueType
Pfam:CBFNT 1 79 1.3e-16 PFAM
RRM 98 170 3.85e-25 SMART
RRM 183 255 7.76e-21 SMART
low complexity region 262 268 N/A INTRINSIC
low complexity region 270 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072750
SMART Domains Protein: ENSMUSP00000072533
Gene: ENSMUSG00000000568

DomainStartEndE-ValueType
low complexity region 7 66 N/A INTRINSIC
RRM 79 151 3.85e-25 SMART
RRM 164 236 7.76e-21 SMART
low complexity region 243 249 N/A INTRINSIC
low complexity region 251 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112939
AA Change: T302A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108561
Gene: ENSMUSG00000000568
AA Change: T302A

DomainStartEndE-ValueType
low complexity region 7 66 N/A INTRINSIC
RRM 79 151 3.85e-25 SMART
RRM 164 236 7.76e-21 SMART
low complexity region 243 249 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
low complexity region 272 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164833
AA Change: T97A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131785
Gene: ENSMUSG00000000568
AA Change: T97A

DomainStartEndE-ValueType
Blast:RRM 1 31 3e-13 BLAST
PDB:1X0F|A 1 35 1e-17 PDB
SCOP:d1fj7a_ 1 40 4e-4 SMART
low complexity region 46 61 N/A INTRINSIC
low complexity region 67 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168396
SMART Domains Protein: ENSMUSP00000131859
Gene: ENSMUSG00000000568

DomainStartEndE-ValueType
Pfam:CBFNT 1 79 2.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170912
Predicted Effect probably benign
Transcript: ENSMUST00000171106
SMART Domains Protein: ENSMUSP00000131262
Gene: ENSMUSG00000000568

DomainStartEndE-ValueType
RRM 8 80 3.85e-25 SMART
RRM 93 165 7.76e-21 SMART
low complexity region 172 178 N/A INTRINSIC
low complexity region 180 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171640
SMART Domains Protein: ENSMUSP00000127833
Gene: ENSMUSG00000000568

DomainStartEndE-ValueType
RRM 27 99 7.76e-21 SMART
low complexity region 106 112 N/A INTRINSIC
low complexity region 114 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171786
SMART Domains Protein: ENSMUSP00000125984
Gene: ENSMUSG00000000568

DomainStartEndE-ValueType
RRM 1 72 8.44e-22 SMART
internal_repeat_1 86 107 2.75e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000172361
AA Change: T321A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132735
Gene: ENSMUSG00000000568
AA Change: T321A

DomainStartEndE-ValueType
Pfam:CBFNT 1 78 9.6e-16 PFAM
RRM 98 170 3.85e-25 SMART
RRM 183 255 7.76e-21 SMART
low complexity region 262 268 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
low complexity region 291 340 N/A INTRINSIC
Meta Mutation Damage Score 0.1001 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are nucleic acid binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It localizes to both the nucleus and the cytoplasm. This protein is implicated in the regulation of mRNA stability. Alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in fetal growth retardation and decreased body weight. Mice show increased susceptibility to bacterial infection and endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,387,020 V613A probably benign Het
Cdh23 A T 10: 60,487,114 L337Q probably damaging Het
Chrna6 A G 8: 27,407,027 L274P probably damaging Het
Ciita G A 16: 10,512,491 probably null Het
Csnka2ip A T 16: 64,478,695 probably benign Het
Ddx60 G A 8: 62,037,069 D1691N probably damaging Het
Dnah7b T C 1: 46,195,120 I1441T probably damaging Het
Dock4 T C 12: 40,834,635 S1713P probably benign Het
Ep400 T C 5: 110,711,152 probably benign Het
Epn1 T C 7: 5,089,944 I85T probably damaging Het
Eri2 T C 7: 119,786,789 K228E probably damaging Het
Garem1 C T 18: 21,147,770 A510T probably benign Het
Gfm2 T A 13: 97,163,064 probably null Het
Gm37596 T C 3: 93,692,216 N282S probably benign Het
Gm4858 A G 3: 93,074,110 H145R probably benign Het
Htr2a A T 14: 74,645,164 I197F probably damaging Het
Krtap2-4 T A 11: 99,614,473 probably benign Het
Lcn3 C A 2: 25,767,811 Y179* probably null Het
Mak A T 13: 41,048,102 M261K probably damaging Het
March7 A G 2: 60,240,966 T605A probably damaging Het
Mcm4 A C 16: 15,636,335 F83V probably benign Het
Myo18b T C 5: 112,802,392 N1546S probably benign Het
Nckap1 T A 2: 80,508,716 K989N probably damaging Het
Ndufaf5 A G 2: 140,181,602 D119G probably damaging Het
Olfr846 A T 9: 19,360,689 V222D probably damaging Het
Pcdh1 T C 18: 38,203,475 T36A possibly damaging Het
Pitpna C T 11: 75,603,731 T100I possibly damaging Het
Pmf1 A T 3: 88,399,189 L102Q probably damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Robo3 A G 9: 37,429,880 L10P probably benign Het
Serpinb6a T C 13: 33,918,818 I241V possibly damaging Het
St14 A T 9: 31,129,660 probably null Het
Stat6 T C 10: 127,658,702 probably null Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tgfbrap1 A T 1: 43,051,904 V687E probably damaging Het
Trim30d A T 7: 104,483,427 S68T probably damaging Het
Ttn A G 2: 76,832,909 probably benign Het
Ugt3a1 A T 15: 9,292,072 D97V probably benign Het
Ugt8a G A 3: 125,915,601 probably benign Het
Vmn1r184 A T 7: 26,267,325 K165N probably benign Het
Vmn2r86 T A 10: 130,448,654 I523F probably damaging Het
Wapl G A 14: 34,722,354 V588I probably benign Het
Wdr7 C T 18: 63,791,867 P974S probably benign Het
Zfp975 T C 7: 42,665,056 D31G possibly damaging Het
Other mutations in Hnrnpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0066:Hnrnpd UTSW 5 99964701 missense probably damaging 1.00
R0066:Hnrnpd UTSW 5 99964701 missense probably damaging 1.00
R1022:Hnrnpd UTSW 5 99966157 makesense probably null
R1024:Hnrnpd UTSW 5 99966157 makesense probably null
R6019:Hnrnpd UTSW 5 99967236 missense probably benign 0.00
R6502:Hnrnpd UTSW 5 99966166 missense probably damaging 1.00
R6785:Hnrnpd UTSW 5 99978424 missense probably benign 0.12
R7080:Hnrnpd UTSW 5 99976533 critical splice donor site probably null
R7577:Hnrnpd UTSW 5 99967254 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTAAGCAAGAAAATGGCTGC -3'
(R):5'- AGCTGTAACCTAAGTTGACTCTCTC -3'

Sequencing Primer
(F):5'- AAATGGCTGCAGTTTATTTTCCAGG -3'
(R):5'- AAGTTGACTCTCTCAAGCTTTTCTG -3'
Posted On2018-11-06