Incidental Mutation 'R6937:Eri2'
ID540343
Institutional Source Beutler Lab
Gene Symbol Eri2
Ensembl Gene ENSMUSG00000030929
Gene Nameexoribonuclease 2
Synonyms4933424N09Rik, Exod1
MMRRC Submission
Accession Numbers

Genbank: NM_027698

Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6937 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location119768679-119794058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119786789 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 228 (K228E)
Ref Sequence ENSEMBL: ENSMUSP00000120547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033224] [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529] [ENSMUST00000139192] [ENSMUST00000150844]
Predicted Effect probably benign
Transcript: ENSMUST00000033224
Predicted Effect probably benign
Transcript: ENSMUST00000063770
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000063902
AA Change: K228E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929
AA Change: K228E

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106523
AA Change: K228E

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929
AA Change: K228E

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106526
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106527
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106528
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106529
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139192
SMART Domains Protein: ENSMUSP00000117940
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
Pfam:RNase_T 21 160 1.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150844
AA Change: K228E

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120547
Gene: ENSMUSG00000030929
AA Change: K228E

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
low complexity region 362 381 N/A INTRINSIC
Pfam:zf-GRF 592 640 1.4e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,387,020 V613A probably benign Het
Cdh23 A T 10: 60,487,114 L337Q probably damaging Het
Chrna6 A G 8: 27,407,027 L274P probably damaging Het
Ciita G A 16: 10,512,491 probably null Het
Csnka2ip A T 16: 64,478,695 probably benign Het
Ddx60 G A 8: 62,037,069 D1691N probably damaging Het
Dnah7b T C 1: 46,195,120 I1441T probably damaging Het
Dock4 T C 12: 40,834,635 S1713P probably benign Het
Ep400 T C 5: 110,711,152 probably benign Het
Epn1 T C 7: 5,089,944 I85T probably damaging Het
Garem1 C T 18: 21,147,770 A510T probably benign Het
Gfm2 T A 13: 97,163,064 probably null Het
Gm37596 T C 3: 93,692,216 N282S probably benign Het
Gm4858 A G 3: 93,074,110 H145R probably benign Het
Hnrnpd T C 5: 99,963,770 T321A probably benign Het
Htr2a A T 14: 74,645,164 I197F probably damaging Het
Krtap2-4 T A 11: 99,614,473 probably benign Het
Lcn3 C A 2: 25,767,811 Y179* probably null Het
Mak A T 13: 41,048,102 M261K probably damaging Het
March7 A G 2: 60,240,966 T605A probably damaging Het
Mcm4 A C 16: 15,636,335 F83V probably benign Het
Myo18b T C 5: 112,802,392 N1546S probably benign Het
Nckap1 T A 2: 80,508,716 K989N probably damaging Het
Ndufaf5 A G 2: 140,181,602 D119G probably damaging Het
Olfr846 A T 9: 19,360,689 V222D probably damaging Het
Pcdh1 T C 18: 38,203,475 T36A possibly damaging Het
Pitpna C T 11: 75,603,731 T100I possibly damaging Het
Pmf1 A T 3: 88,399,189 L102Q probably damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Robo3 A G 9: 37,429,880 L10P probably benign Het
Serpinb6a T C 13: 33,918,818 I241V possibly damaging Het
St14 A T 9: 31,129,660 probably null Het
Stat6 T C 10: 127,658,702 probably null Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tgfbrap1 A T 1: 43,051,904 V687E probably damaging Het
Trim30d A T 7: 104,483,427 S68T probably damaging Het
Ttn A G 2: 76,832,909 probably benign Het
Ugt3a1 A T 15: 9,292,072 D97V probably benign Het
Ugt8a G A 3: 125,915,601 probably benign Het
Vmn1r184 A T 7: 26,267,325 K165N probably benign Het
Vmn2r86 T A 10: 130,448,654 I523F probably damaging Het
Wapl G A 14: 34,722,354 V588I probably benign Het
Wdr7 C T 18: 63,791,867 P974S probably benign Het
Zfp975 T C 7: 42,665,056 D31G possibly damaging Het
Other mutations in Eri2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Eri2 APN 7 119787741 missense probably benign 0.44
IGL00987:Eri2 APN 7 119791166 missense probably damaging 1.00
IGL01139:Eri2 APN 7 119786737 critical splice donor site probably null
IGL01476:Eri2 APN 7 119790249 missense probably damaging 1.00
IGL02019:Eri2 APN 7 119786080 nonsense probably null
IGL02208:Eri2 APN 7 119785935 missense probably benign 0.00
IGL02395:Eri2 APN 7 119787810 missense probably damaging 0.98
IGL02405:Eri2 APN 7 119785482 missense probably damaging 1.00
IGL02646:Eri2 APN 7 119786108 missense possibly damaging 0.87
IGL02659:Eri2 APN 7 119787442 missense probably damaging 0.98
alien UTSW 7 119791174 missense probably damaging 1.00
extraterrestrial UTSW 7 119793916 critical splice donor site probably null
G5030:Eri2 UTSW 7 119786378 missense possibly damaging 0.58
K7894:Eri2 UTSW 7 119785271 missense probably benign 0.39
PIT4434001:Eri2 UTSW 7 119786301 missense probably benign 0.00
R0152:Eri2 UTSW 7 119790383 missense probably damaging 1.00
R0378:Eri2 UTSW 7 119793916 critical splice donor site probably null
R0532:Eri2 UTSW 7 119785983 missense probably benign 0.22
R0630:Eri2 UTSW 7 119786417 missense probably benign 0.27
R1192:Eri2 UTSW 7 119792317 missense probably damaging 1.00
R1416:Eri2 UTSW 7 119791174 missense probably damaging 1.00
R1884:Eri2 UTSW 7 119791123 missense probably benign 0.12
R2173:Eri2 UTSW 7 119786543 missense possibly damaging 0.67
R2961:Eri2 UTSW 7 119785344 missense probably benign
R3805:Eri2 UTSW 7 119786008 nonsense probably null
R3807:Eri2 UTSW 7 119786008 nonsense probably null
R4534:Eri2 UTSW 7 119790243 missense probably damaging 1.00
R4738:Eri2 UTSW 7 119787732 critical splice donor site probably null
R4776:Eri2 UTSW 7 119784946 utr 3 prime probably benign
R4780:Eri2 UTSW 7 119785680 missense probably benign 0.43
R5037:Eri2 UTSW 7 119785674 missense probably benign
R5260:Eri2 UTSW 7 119787846 splice site probably benign
R5315:Eri2 UTSW 7 119786018 missense probably benign 0.00
R5884:Eri2 UTSW 7 119772329 makesense probably null
R5927:Eri2 UTSW 7 119786068 missense probably damaging 1.00
R7296:Eri2 UTSW 7 119786516 nonsense probably null
R7302:Eri2 UTSW 7 119786786 missense probably benign 0.38
R7480:Eri2 UTSW 7 119786511 nonsense probably null
R7494:Eri2 UTSW 7 119786081 missense probably damaging 0.99
R7524:Eri2 UTSW 7 119785749 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATCCATTGCTTTAGGAACCG -3'
(R):5'- TCCTCACAGGCCAATCATGATG -3'

Sequencing Primer
(F):5'- GAACATGACTACTACCCGA -3'
(R):5'- CAGGCCAATCATGATGATTAAAATC -3'
Posted On2018-11-06