Incidental Mutation 'R6937:Cdh23'
ID 540349
Institutional Source Beutler Lab
Gene Symbol Cdh23
Ensembl Gene ENSMUSG00000012819
Gene Name cadherin related 23 (otocadherin)
Synonyms bob, sals, USH1D, ahl, mdfw, nmf252, 4930542A03Rik, nmf112, nmf181
MMRRC Submission 045051-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.428) question?
Stock # R6937 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 60138527-60532269 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60322893 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 337 (L337Q)
Ref Sequence ENSEMBL: ENSMUSP00000101101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000073242
AA Change: L337Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: L337Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105461
AA Change: L337Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: L337Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105462
AA Change: L340Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: L340Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105463
AA Change: L337Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: L337Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105464
AA Change: L337Q

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: L337Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,222,889 (GRCm39) V613A probably benign Het
Chrna6 A G 8: 27,897,055 (GRCm39) L274P probably damaging Het
Ciita G A 16: 10,330,355 (GRCm39) probably null Het
Csnka2ip A T 16: 64,299,058 (GRCm39) probably benign Het
Ddx60 G A 8: 62,490,103 (GRCm39) D1691N probably damaging Het
Dnah7b T C 1: 46,234,280 (GRCm39) I1441T probably damaging Het
Dock4 T C 12: 40,884,634 (GRCm39) S1713P probably benign Het
Ep400 T C 5: 110,859,018 (GRCm39) probably benign Het
Epn1 T C 7: 5,092,943 (GRCm39) I85T probably damaging Het
Eri2 T C 7: 119,386,012 (GRCm39) K228E probably damaging Het
Garem1 C T 18: 21,280,827 (GRCm39) A510T probably benign Het
Gfm2 T A 13: 97,299,572 (GRCm39) probably null Het
Hnrnpd T C 5: 100,111,629 (GRCm39) T321A probably benign Het
Htr2a A T 14: 74,882,604 (GRCm39) I197F probably damaging Het
Krtap2-4 T A 11: 99,505,299 (GRCm39) probably benign Het
Lcn3 C A 2: 25,657,823 (GRCm39) Y179* probably null Het
Mak A T 13: 41,201,578 (GRCm39) M261K probably damaging Het
Marchf7 A G 2: 60,071,310 (GRCm39) T605A probably damaging Het
Mcm4 A C 16: 15,454,199 (GRCm39) F83V probably benign Het
Myo18b T C 5: 112,950,258 (GRCm39) N1546S probably benign Het
Nckap1 T A 2: 80,339,060 (GRCm39) K989N probably damaging Het
Ndufaf5 A G 2: 140,023,522 (GRCm39) D119G probably damaging Het
Or7g28 A T 9: 19,271,985 (GRCm39) V222D probably damaging Het
Pcdh1 T C 18: 38,336,528 (GRCm39) T36A possibly damaging Het
Pitpna C T 11: 75,494,557 (GRCm39) T100I possibly damaging Het
Pmf1 A T 3: 88,306,496 (GRCm39) L102Q probably damaging Het
Rftn2 T C 1: 55,233,508 (GRCm39) probably null Het
Robo3 A G 9: 37,341,176 (GRCm39) L10P probably benign Het
Serpinb6a T C 13: 34,102,801 (GRCm39) I241V possibly damaging Het
St14 A T 9: 31,040,956 (GRCm39) probably null Het
Stat6 T C 10: 127,494,571 (GRCm39) probably null Het
Tdpoz6 T C 3: 93,599,523 (GRCm39) N282S probably benign Het
Tdpoz8 A G 3: 92,981,417 (GRCm39) H145R probably benign Het
Tenm4 G A 7: 96,202,703 (GRCm39) R106H probably benign Het
Tgfbrap1 A T 1: 43,091,064 (GRCm39) V687E probably damaging Het
Trim30d A T 7: 104,132,634 (GRCm39) S68T probably damaging Het
Ttn A G 2: 76,663,253 (GRCm39) probably benign Het
Ugt3a1 A T 15: 9,292,158 (GRCm39) D97V probably benign Het
Ugt8a G A 3: 125,709,250 (GRCm39) probably benign Het
Vmn1r184 A T 7: 25,966,750 (GRCm39) K165N probably benign Het
Vmn2r86 T A 10: 130,284,523 (GRCm39) I523F probably damaging Het
Wapl G A 14: 34,444,311 (GRCm39) V588I probably benign Het
Wdr7 C T 18: 63,924,938 (GRCm39) P974S probably benign Het
Zfp975 T C 7: 42,314,480 (GRCm39) D31G possibly damaging Het
Other mutations in Cdh23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Cdh23 APN 10 60,359,327 (GRCm39) missense probably benign 0.03
IGL00429:Cdh23 APN 10 60,256,920 (GRCm39) missense probably damaging 0.97
IGL01014:Cdh23 APN 10 60,143,301 (GRCm39) missense probably damaging 0.99
IGL01284:Cdh23 APN 10 60,301,876 (GRCm39) missense possibly damaging 0.95
IGL01305:Cdh23 APN 10 60,148,403 (GRCm39) missense probably damaging 1.00
IGL01367:Cdh23 APN 10 60,146,566 (GRCm39) missense probably damaging 1.00
IGL01396:Cdh23 APN 10 60,220,848 (GRCm39) missense possibly damaging 0.93
IGL01412:Cdh23 APN 10 60,150,473 (GRCm39) missense probably damaging 1.00
IGL01461:Cdh23 APN 10 60,244,926 (GRCm39) missense possibly damaging 0.53
IGL01469:Cdh23 APN 10 60,433,504 (GRCm39) missense probably benign 0.03
IGL01695:Cdh23 APN 10 60,167,612 (GRCm39) missense probably benign 0.20
IGL01734:Cdh23 APN 10 60,139,292 (GRCm39) missense probably benign
IGL01767:Cdh23 APN 10 60,151,503 (GRCm39) missense probably damaging 1.00
IGL01796:Cdh23 APN 10 60,146,916 (GRCm39) missense probably benign 0.31
IGL01843:Cdh23 APN 10 60,255,598 (GRCm39) splice site probably null
IGL02025:Cdh23 APN 10 60,220,922 (GRCm39) missense probably damaging 1.00
IGL02071:Cdh23 APN 10 60,359,339 (GRCm39) missense possibly damaging 0.93
IGL02160:Cdh23 APN 10 60,433,544 (GRCm39) splice site probably benign
IGL02175:Cdh23 APN 10 60,167,087 (GRCm39) missense possibly damaging 0.92
IGL02220:Cdh23 APN 10 60,140,903 (GRCm39) missense probably damaging 1.00
IGL02302:Cdh23 APN 10 60,159,302 (GRCm39) missense possibly damaging 0.87
IGL02331:Cdh23 APN 10 60,301,322 (GRCm39) missense probably damaging 0.99
IGL02452:Cdh23 APN 10 60,153,721 (GRCm39) missense probably damaging 0.99
IGL02499:Cdh23 APN 10 60,220,958 (GRCm39) missense probably damaging 1.00
IGL02548:Cdh23 APN 10 60,485,901 (GRCm39) missense probably benign 0.37
IGL02593:Cdh23 APN 10 60,301,774 (GRCm39) splice site probably benign
IGL02626:Cdh23 APN 10 60,227,580 (GRCm39) missense probably damaging 1.00
IGL02951:Cdh23 APN 10 60,147,143 (GRCm39) missense probably damaging 1.00
IGL03145:Cdh23 APN 10 60,212,593 (GRCm39) missense probably damaging 0.99
dee_dee UTSW 10 60,143,835 (GRCm39) nonsense probably null
hersey UTSW 10 60,143,815 (GRCm39) missense probably damaging 1.00
ANU22:Cdh23 UTSW 10 60,148,403 (GRCm39) missense probably damaging 1.00
IGL02980:Cdh23 UTSW 10 60,150,399 (GRCm39) missense probably damaging 1.00
PIT4362001:Cdh23 UTSW 10 60,301,237 (GRCm39) missense probably benign 0.15
R0013:Cdh23 UTSW 10 60,248,952 (GRCm39) missense possibly damaging 0.90
R0045:Cdh23 UTSW 10 60,366,757 (GRCm39) missense probably damaging 1.00
R0045:Cdh23 UTSW 10 60,366,757 (GRCm39) missense probably damaging 1.00
R0082:Cdh23 UTSW 10 60,148,366 (GRCm39) missense probably damaging 1.00
R0124:Cdh23 UTSW 10 60,143,835 (GRCm39) nonsense probably null
R0172:Cdh23 UTSW 10 60,155,411 (GRCm39) missense probably damaging 1.00
R0195:Cdh23 UTSW 10 60,152,838 (GRCm39) missense probably damaging 0.99
R0365:Cdh23 UTSW 10 60,215,094 (GRCm39) missense probably damaging 0.99
R0437:Cdh23 UTSW 10 60,246,576 (GRCm39) missense probably damaging 1.00
R0486:Cdh23 UTSW 10 60,222,725 (GRCm39) missense probably damaging 1.00
R0494:Cdh23 UTSW 10 60,152,375 (GRCm39) splice site probably benign
R0545:Cdh23 UTSW 10 60,167,070 (GRCm39) missense probably benign 0.06
R0619:Cdh23 UTSW 10 60,269,556 (GRCm39) missense probably damaging 1.00
R0647:Cdh23 UTSW 10 60,159,153 (GRCm39) nonsense probably null
R0647:Cdh23 UTSW 10 60,143,681 (GRCm39) missense probably damaging 0.99
R0730:Cdh23 UTSW 10 60,159,493 (GRCm39) missense probably damaging 0.99
R0880:Cdh23 UTSW 10 60,242,200 (GRCm39) missense possibly damaging 0.51
R0942:Cdh23 UTSW 10 60,246,639 (GRCm39) missense possibly damaging 0.67
R0989:Cdh23 UTSW 10 60,370,289 (GRCm39) missense probably damaging 0.99
R1017:Cdh23 UTSW 10 60,167,572 (GRCm39) missense probably damaging 1.00
R1173:Cdh23 UTSW 10 60,148,171 (GRCm39) splice site probably benign
R1449:Cdh23 UTSW 10 60,212,730 (GRCm39) missense probably damaging 1.00
R1456:Cdh23 UTSW 10 60,322,899 (GRCm39) missense possibly damaging 0.84
R1519:Cdh23 UTSW 10 60,215,122 (GRCm39) missense possibly damaging 0.92
R1532:Cdh23 UTSW 10 60,150,110 (GRCm39) missense probably damaging 0.99
R1559:Cdh23 UTSW 10 60,255,478 (GRCm39) splice site probably benign
R1704:Cdh23 UTSW 10 60,150,390 (GRCm39) missense probably damaging 1.00
R1711:Cdh23 UTSW 10 60,359,315 (GRCm39) missense probably benign 0.07
R1760:Cdh23 UTSW 10 60,161,855 (GRCm39) missense probably damaging 1.00
R1782:Cdh23 UTSW 10 60,324,321 (GRCm39) missense probably damaging 1.00
R1791:Cdh23 UTSW 10 60,227,505 (GRCm39) missense possibly damaging 0.89
R1803:Cdh23 UTSW 10 60,167,060 (GRCm39) missense probably damaging 1.00
R1857:Cdh23 UTSW 10 60,159,076 (GRCm39) missense probably damaging 1.00
R1874:Cdh23 UTSW 10 60,272,597 (GRCm39) missense possibly damaging 0.52
R1914:Cdh23 UTSW 10 60,159,349 (GRCm39) missense probably damaging 0.99
R1958:Cdh23 UTSW 10 60,246,652 (GRCm39) missense probably benign 0.02
R1964:Cdh23 UTSW 10 60,221,001 (GRCm39) missense probably benign 0.31
R1966:Cdh23 UTSW 10 60,159,361 (GRCm39) missense probably damaging 1.00
R1981:Cdh23 UTSW 10 60,214,530 (GRCm39) missense probably damaging 1.00
R2010:Cdh23 UTSW 10 60,150,006 (GRCm39) missense probably damaging 0.99
R2036:Cdh23 UTSW 10 60,301,822 (GRCm39) missense possibly damaging 0.52
R2038:Cdh23 UTSW 10 60,148,366 (GRCm39) missense probably damaging 1.00
R2044:Cdh23 UTSW 10 60,432,509 (GRCm39) missense possibly damaging 0.72
R2111:Cdh23 UTSW 10 60,141,362 (GRCm39) missense probably damaging 0.99
R2112:Cdh23 UTSW 10 60,141,362 (GRCm39) missense probably damaging 0.99
R2211:Cdh23 UTSW 10 60,301,783 (GRCm39) missense possibly damaging 0.92
R2261:Cdh23 UTSW 10 60,152,907 (GRCm39) missense probably damaging 1.00
R2262:Cdh23 UTSW 10 60,152,907 (GRCm39) missense probably damaging 1.00
R2306:Cdh23 UTSW 10 60,159,224 (GRCm39) missense probably damaging 1.00
R2344:Cdh23 UTSW 10 60,152,503 (GRCm39) missense probably damaging 1.00
R2857:Cdh23 UTSW 10 60,218,432 (GRCm39) critical splice donor site probably null
R2858:Cdh23 UTSW 10 60,218,432 (GRCm39) critical splice donor site probably null
R2859:Cdh23 UTSW 10 60,218,432 (GRCm39) critical splice donor site probably null
R2876:Cdh23 UTSW 10 60,143,275 (GRCm39) missense probably damaging 1.00
R3034:Cdh23 UTSW 10 60,244,789 (GRCm39) splice site probably benign
R3424:Cdh23 UTSW 10 60,212,660 (GRCm39) missense possibly damaging 0.76
R3699:Cdh23 UTSW 10 60,163,149 (GRCm39) critical splice donor site probably null
R3700:Cdh23 UTSW 10 60,163,149 (GRCm39) critical splice donor site probably null
R3950:Cdh23 UTSW 10 60,493,105 (GRCm39) missense probably benign 0.04
R3951:Cdh23 UTSW 10 60,493,105 (GRCm39) missense probably benign 0.04
R3952:Cdh23 UTSW 10 60,493,105 (GRCm39) missense probably benign 0.04
R4108:Cdh23 UTSW 10 60,246,601 (GRCm39) missense possibly damaging 0.51
R4114:Cdh23 UTSW 10 60,256,819 (GRCm39) splice site probably null
R4273:Cdh23 UTSW 10 60,146,940 (GRCm39) missense possibly damaging 0.69
R4284:Cdh23 UTSW 10 60,139,272 (GRCm39) missense possibly damaging 0.91
R4334:Cdh23 UTSW 10 60,220,838 (GRCm39) missense probably damaging 0.99
R4474:Cdh23 UTSW 10 60,146,865 (GRCm39) missense probably damaging 1.00
R4532:Cdh23 UTSW 10 60,370,202 (GRCm39) missense probably benign 0.32
R4597:Cdh23 UTSW 10 60,244,823 (GRCm39) missense probably damaging 1.00
R4604:Cdh23 UTSW 10 60,173,445 (GRCm39) missense possibly damaging 0.93
R4793:Cdh23 UTSW 10 60,167,129 (GRCm39) missense probably damaging 1.00
R4816:Cdh23 UTSW 10 60,244,856 (GRCm39) missense possibly damaging 0.93
R4833:Cdh23 UTSW 10 60,220,817 (GRCm39) missense probably damaging 1.00
R4840:Cdh23 UTSW 10 60,255,556 (GRCm39) missense possibly damaging 0.53
R4857:Cdh23 UTSW 10 60,227,563 (GRCm39) missense probably damaging 1.00
R4869:Cdh23 UTSW 10 60,212,713 (GRCm39) missense probably damaging 1.00
R4894:Cdh23 UTSW 10 60,173,630 (GRCm39) missense probably benign 0.04
R4940:Cdh23 UTSW 10 60,143,714 (GRCm39) missense probably damaging 0.98
R5020:Cdh23 UTSW 10 60,143,811 (GRCm39) missense probably damaging 0.99
R5026:Cdh23 UTSW 10 60,140,627 (GRCm39) missense possibly damaging 0.88
R5081:Cdh23 UTSW 10 60,272,586 (GRCm39) missense possibly damaging 0.89
R5138:Cdh23 UTSW 10 60,148,061 (GRCm39) missense probably damaging 1.00
R5236:Cdh23 UTSW 10 60,148,351 (GRCm39) missense probably damaging 1.00
R5361:Cdh23 UTSW 10 60,493,044 (GRCm39) critical splice donor site probably null
R5384:Cdh23 UTSW 10 60,173,541 (GRCm39) missense probably damaging 0.99
R5500:Cdh23 UTSW 10 60,150,090 (GRCm39) missense probably damaging 1.00
R5512:Cdh23 UTSW 10 60,370,165 (GRCm39) splice site probably null
R5673:Cdh23 UTSW 10 60,143,636 (GRCm39) missense probably damaging 1.00
R5720:Cdh23 UTSW 10 60,228,802 (GRCm39) missense possibly damaging 0.71
R5726:Cdh23 UTSW 10 60,243,259 (GRCm39) missense probably damaging 0.98
R5732:Cdh23 UTSW 10 60,167,096 (GRCm39) missense possibly damaging 0.80
R5739:Cdh23 UTSW 10 60,141,388 (GRCm39) missense probably damaging 0.99
R5760:Cdh23 UTSW 10 60,242,171 (GRCm39) missense probably damaging 0.99
R5793:Cdh23 UTSW 10 60,141,907 (GRCm39) missense probably damaging 1.00
R5880:Cdh23 UTSW 10 60,220,713 (GRCm39) missense probably damaging 1.00
R5905:Cdh23 UTSW 10 60,370,314 (GRCm39) missense probably damaging 0.98
R5907:Cdh23 UTSW 10 60,264,158 (GRCm39) missense probably damaging 1.00
R5910:Cdh23 UTSW 10 60,213,600 (GRCm39) missense possibly damaging 0.81
R5932:Cdh23 UTSW 10 60,228,763 (GRCm39) missense probably damaging 1.00
R5996:Cdh23 UTSW 10 60,249,356 (GRCm39) missense possibly damaging 0.85
R6015:Cdh23 UTSW 10 60,143,761 (GRCm39) missense probably damaging 0.97
R6020:Cdh23 UTSW 10 60,167,105 (GRCm39) missense probably damaging 1.00
R6023:Cdh23 UTSW 10 60,301,321 (GRCm39) missense probably damaging 1.00
R6028:Cdh23 UTSW 10 60,370,314 (GRCm39) missense probably damaging 0.98
R6066:Cdh23 UTSW 10 60,269,537 (GRCm39) missense probably damaging 1.00
R6137:Cdh23 UTSW 10 60,270,291 (GRCm39) missense probably damaging 0.96
R6211:Cdh23 UTSW 10 60,246,600 (GRCm39) missense possibly damaging 0.90
R6298:Cdh23 UTSW 10 60,262,451 (GRCm39) nonsense probably null
R6302:Cdh23 UTSW 10 60,140,872 (GRCm39) missense possibly damaging 0.74
R6338:Cdh23 UTSW 10 60,248,930 (GRCm39) missense probably damaging 1.00
R6356:Cdh23 UTSW 10 60,274,626 (GRCm39) missense probably damaging 1.00
R6441:Cdh23 UTSW 10 60,143,815 (GRCm39) missense probably damaging 1.00
R6714:Cdh23 UTSW 10 60,167,609 (GRCm39) missense possibly damaging 0.62
R6760:Cdh23 UTSW 10 60,141,947 (GRCm39) missense probably damaging 1.00
R6807:Cdh23 UTSW 10 60,214,650 (GRCm39) missense possibly damaging 0.95
R6855:Cdh23 UTSW 10 60,141,901 (GRCm39) missense possibly damaging 0.66
R6942:Cdh23 UTSW 10 60,274,635 (GRCm39) missense possibly damaging 0.93
R6961:Cdh23 UTSW 10 60,485,893 (GRCm39) missense probably benign 0.00
R7009:Cdh23 UTSW 10 60,173,085 (GRCm39) missense probably damaging 0.99
R7010:Cdh23 UTSW 10 60,366,770 (GRCm39) missense probably benign 0.03
R7032:Cdh23 UTSW 10 60,167,567 (GRCm39) missense probably damaging 1.00
R7046:Cdh23 UTSW 10 60,214,530 (GRCm39) missense probably damaging 1.00
R7111:Cdh23 UTSW 10 60,222,823 (GRCm39) missense probably damaging 1.00
R7196:Cdh23 UTSW 10 60,143,759 (GRCm39) missense probably damaging 0.99
R7198:Cdh23 UTSW 10 60,148,378 (GRCm39) missense possibly damaging 0.91
R7223:Cdh23 UTSW 10 60,167,596 (GRCm39) missense probably damaging 1.00
R7290:Cdh23 UTSW 10 60,212,620 (GRCm39) missense probably benign
R7335:Cdh23 UTSW 10 60,140,895 (GRCm39) missense probably damaging 1.00
R7340:Cdh23 UTSW 10 60,366,775 (GRCm39) missense probably benign 0.19
R7350:Cdh23 UTSW 10 60,246,689 (GRCm39) missense probably damaging 1.00
R7366:Cdh23 UTSW 10 60,151,471 (GRCm39) nonsense probably null
R7374:Cdh23 UTSW 10 60,153,679 (GRCm39) missense probably damaging 0.99
R7455:Cdh23 UTSW 10 60,142,003 (GRCm39) missense possibly damaging 0.82
R7537:Cdh23 UTSW 10 60,220,724 (GRCm39) missense probably benign 0.17
R7573:Cdh23 UTSW 10 60,159,329 (GRCm39) missense probably benign 0.17
R7578:Cdh23 UTSW 10 60,243,186 (GRCm39) missense probably benign 0.14
R7646:Cdh23 UTSW 10 60,140,931 (GRCm39) missense possibly damaging 0.95
R7703:Cdh23 UTSW 10 60,173,043 (GRCm39) missense probably damaging 1.00
R7763:Cdh23 UTSW 10 60,148,356 (GRCm39) missense probably damaging 1.00
R7797:Cdh23 UTSW 10 60,220,973 (GRCm39) missense probably benign 0.07
R7867:Cdh23 UTSW 10 60,150,390 (GRCm39) missense probably damaging 1.00
R7878:Cdh23 UTSW 10 60,149,979 (GRCm39) missense possibly damaging 0.69
R7915:Cdh23 UTSW 10 60,143,668 (GRCm39) missense probably damaging 0.97
R7922:Cdh23 UTSW 10 60,218,485 (GRCm39) missense probably benign 0.31
R7963:Cdh23 UTSW 10 60,171,967 (GRCm39) missense probably damaging 1.00
R7997:Cdh23 UTSW 10 60,432,518 (GRCm39) missense possibly damaging 0.81
R8167:Cdh23 UTSW 10 60,150,162 (GRCm39) missense probably benign 0.12
R8167:Cdh23 UTSW 10 60,173,472 (GRCm39) missense probably damaging 0.96
R8258:Cdh23 UTSW 10 60,151,435 (GRCm39) missense probably damaging 0.99
R8259:Cdh23 UTSW 10 60,151,435 (GRCm39) missense probably damaging 0.99
R8317:Cdh23 UTSW 10 60,272,568 (GRCm39) missense probably damaging 1.00
R8317:Cdh23 UTSW 10 60,147,037 (GRCm39) critical splice donor site probably null
R8326:Cdh23 UTSW 10 60,274,591 (GRCm39) missense possibly damaging 0.55
R8333:Cdh23 UTSW 10 60,150,390 (GRCm39) missense probably damaging 1.00
R8348:Cdh23 UTSW 10 60,167,507 (GRCm39) missense probably benign 0.43
R8366:Cdh23 UTSW 10 60,160,799 (GRCm39) missense probably benign
R8504:Cdh23 UTSW 10 60,274,618 (GRCm39) missense probably benign 0.00
R8676:Cdh23 UTSW 10 60,246,689 (GRCm39) missense probably damaging 1.00
R8781:Cdh23 UTSW 10 60,167,567 (GRCm39) missense probably damaging 1.00
R8785:Cdh23 UTSW 10 60,147,114 (GRCm39) missense probably damaging 1.00
R8788:Cdh23 UTSW 10 60,324,372 (GRCm39) missense probably damaging 1.00
R8802:Cdh23 UTSW 10 60,244,877 (GRCm39) missense probably benign 0.04
R8837:Cdh23 UTSW 10 60,160,755 (GRCm39) missense probably benign 0.28
R8863:Cdh23 UTSW 10 60,212,613 (GRCm39) nonsense probably null
R8889:Cdh23 UTSW 10 60,143,284 (GRCm39) missense probably damaging 0.97
R8892:Cdh23 UTSW 10 60,143,284 (GRCm39) missense probably damaging 0.97
R8921:Cdh23 UTSW 10 60,140,908 (GRCm39) missense probably damaging 0.99
R8980:Cdh23 UTSW 10 60,173,625 (GRCm39) missense probably benign 0.06
R9000:Cdh23 UTSW 10 60,140,277 (GRCm39) missense possibly damaging 0.82
R9043:Cdh23 UTSW 10 60,151,478 (GRCm39) missense probably benign 0.00
R9046:Cdh23 UTSW 10 60,218,303 (GRCm39) intron probably benign
R9070:Cdh23 UTSW 10 60,173,539 (GRCm39) missense probably benign
R9075:Cdh23 UTSW 10 60,153,541 (GRCm39) missense probably damaging 1.00
R9132:Cdh23 UTSW 10 60,270,283 (GRCm39) splice site probably benign
R9155:Cdh23 UTSW 10 60,249,485 (GRCm39) missense probably damaging 0.99
R9171:Cdh23 UTSW 10 60,161,810 (GRCm39) missense probably benign 0.00
R9179:Cdh23 UTSW 10 60,153,664 (GRCm39) missense probably benign 0.06
R9186:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9189:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9207:Cdh23 UTSW 10 60,243,210 (GRCm39) missense probably damaging 1.00
R9240:Cdh23 UTSW 10 60,215,044 (GRCm39) missense probably benign 0.00
R9244:Cdh23 UTSW 10 60,249,442 (GRCm39) missense possibly damaging 0.93
R9284:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9286:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9287:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9302:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9352:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9353:Cdh23 UTSW 10 60,143,306 (GRCm39) missense possibly damaging 0.54
R9423:Cdh23 UTSW 10 60,148,387 (GRCm39) missense probably damaging 1.00
R9513:Cdh23 UTSW 10 60,166,995 (GRCm39) missense probably damaging 0.99
R9577:Cdh23 UTSW 10 60,146,895 (GRCm39) missense probably damaging 1.00
R9598:Cdh23 UTSW 10 60,214,574 (GRCm39) missense probably benign 0.01
R9631:Cdh23 UTSW 10 60,243,168 (GRCm39) missense possibly damaging 0.49
R9652:Cdh23 UTSW 10 60,167,135 (GRCm39) missense probably damaging 1.00
R9725:Cdh23 UTSW 10 60,432,561 (GRCm39) missense probably benign 0.02
X0052:Cdh23 UTSW 10 60,220,913 (GRCm39) missense probably damaging 1.00
Z1088:Cdh23 UTSW 10 60,249,423 (GRCm39) missense probably benign 0.35
Z1176:Cdh23 UTSW 10 60,264,100 (GRCm39) missense probably benign
Z1176:Cdh23 UTSW 10 60,146,549 (GRCm39) missense probably damaging 1.00
Z1177:Cdh23 UTSW 10 60,270,393 (GRCm39) critical splice acceptor site probably null
Z1177:Cdh23 UTSW 10 60,159,334 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGCTAGTGCTGCCTAGACTAGG -3'
(R):5'- CCATGAATGCAGACAGTGGAATCC -3'

Sequencing Primer
(F):5'- CTAGGCGGGCGGTAAGTG -3'
(R):5'- ATGCAGACAGTGGAATCCTCTGC -3'
Posted On 2018-11-06