Incidental Mutation 'R6937:Stat6'
ID540350
Institutional Source Beutler Lab
Gene Symbol Stat6
Ensembl Gene ENSMUSG00000002147
Gene Namesignal transducer and activator of transcription 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.666) question?
Stock #R6937 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127642986-127660957 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 127658702 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026469] [ENSMUST00000092074] [ENSMUST00000099157]
Predicted Effect probably benign
Transcript: ENSMUST00000026469
SMART Domains Protein: ENSMUSP00000026469
Gene: ENSMUSG00000025402

DomainStartEndE-ValueType
Pfam:NCD1 36 114 1.2e-44 PFAM
Pfam:NCD2 230 364 3.2e-59 PFAM
low complexity region 393 406 N/A INTRINSIC
low complexity region 431 446 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092074
SMART Domains Protein: ENSMUSP00000089708
Gene: ENSMUSG00000002147

DomainStartEndE-ValueType
STAT_int 2 116 2.76e-31 SMART
Pfam:STAT_bind 273 526 4.4e-87 PFAM
SH2 540 622 1.33e-5 SMART
Pfam:STAT6_C 655 837 1.1e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099157
SMART Domains Protein: ENSMUSP00000096761
Gene: ENSMUSG00000025402

DomainStartEndE-ValueType
Pfam:NCD1 34 115 4.4e-51 PFAM
Pfam:NCD2 199 366 3.6e-74 PFAM
low complexity region 393 406 N/A INTRINSIC
Meta Mutation Damage Score 0.9586 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein plays a central role in exerting IL4 mediated biological responses. It is found to induce the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. Knockout studies in mice suggested the roles of this gene in differentiation of T helper 2 (Th2) cells, expression of cell surface markers, and class switch of immunoglobulins. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired IL4 responses, including anti-IgM stimulated B cell proliferation, class switching to IgE, contact sensitivity, and Th2 cytokine production, and show increased resistance to certain infections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,387,020 V613A probably benign Het
Cdh23 A T 10: 60,487,114 L337Q probably damaging Het
Chrna6 A G 8: 27,407,027 L274P probably damaging Het
Ciita G A 16: 10,512,491 probably null Het
Csnka2ip A T 16: 64,478,695 probably benign Het
Ddx60 G A 8: 62,037,069 D1691N probably damaging Het
Dnah7b T C 1: 46,195,120 I1441T probably damaging Het
Dock4 T C 12: 40,834,635 S1713P probably benign Het
Ep400 T C 5: 110,711,152 probably benign Het
Epn1 T C 7: 5,089,944 I85T probably damaging Het
Eri2 T C 7: 119,786,789 K228E probably damaging Het
Garem1 C T 18: 21,147,770 A510T probably benign Het
Gfm2 T A 13: 97,163,064 probably null Het
Gm37596 T C 3: 93,692,216 N282S probably benign Het
Gm4858 A G 3: 93,074,110 H145R probably benign Het
Hnrnpd T C 5: 99,963,770 T321A probably benign Het
Htr2a A T 14: 74,645,164 I197F probably damaging Het
Krtap2-4 T A 11: 99,614,473 probably benign Het
Lcn3 C A 2: 25,767,811 Y179* probably null Het
Mak A T 13: 41,048,102 M261K probably damaging Het
March7 A G 2: 60,240,966 T605A probably damaging Het
Mcm4 A C 16: 15,636,335 F83V probably benign Het
Myo18b T C 5: 112,802,392 N1546S probably benign Het
Nckap1 T A 2: 80,508,716 K989N probably damaging Het
Ndufaf5 A G 2: 140,181,602 D119G probably damaging Het
Olfr846 A T 9: 19,360,689 V222D probably damaging Het
Pcdh1 T C 18: 38,203,475 T36A possibly damaging Het
Pitpna C T 11: 75,603,731 T100I possibly damaging Het
Pmf1 A T 3: 88,399,189 L102Q probably damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Robo3 A G 9: 37,429,880 L10P probably benign Het
Serpinb6a T C 13: 33,918,818 I241V possibly damaging Het
St14 A T 9: 31,129,660 probably null Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tgfbrap1 A T 1: 43,051,904 V687E probably damaging Het
Trim30d A T 7: 104,483,427 S68T probably damaging Het
Ttn A G 2: 76,832,909 probably benign Het
Ugt3a1 A T 15: 9,292,072 D97V probably benign Het
Ugt8a G A 3: 125,915,601 probably benign Het
Vmn1r184 A T 7: 26,267,325 K165N probably benign Het
Vmn2r86 T A 10: 130,448,654 I523F probably damaging Het
Wapl G A 14: 34,722,354 V588I probably benign Het
Wdr7 C T 18: 63,791,867 P974S probably benign Het
Zfp975 T C 7: 42,665,056 D31G possibly damaging Het
Other mutations in Stat6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Stat6 APN 10 127654932 missense probably damaging 1.00
IGL01785:Stat6 APN 10 127657227 missense probably damaging 1.00
IGL02939:Stat6 APN 10 127646940 missense probably benign 0.05
IGL03266:Stat6 APN 10 127657155 missense possibly damaging 0.88
IGL03412:Stat6 APN 10 127658205 missense probably benign 0.00
Rigid UTSW 10 127658702 critical splice donor site probably null
Stationary UTSW 10 127652222 missense possibly damaging 0.93
PIT4142001:Stat6 UTSW 10 127658230 missense possibly damaging 0.95
R0165:Stat6 UTSW 10 127657227 missense probably damaging 0.98
R0581:Stat6 UTSW 10 127648116 missense probably damaging 0.99
R0735:Stat6 UTSW 10 127658241 missense probably damaging 1.00
R1333:Stat6 UTSW 10 127651225 missense possibly damaging 0.62
R1352:Stat6 UTSW 10 127650811 missense probably benign 0.32
R1457:Stat6 UTSW 10 127658245 missense probably damaging 0.98
R1538:Stat6 UTSW 10 127653256 missense probably damaging 1.00
R1696:Stat6 UTSW 10 127653049 missense probably damaging 1.00
R2016:Stat6 UTSW 10 127650796 missense probably damaging 1.00
R3236:Stat6 UTSW 10 127652222 missense possibly damaging 0.93
R3980:Stat6 UTSW 10 127655379 missense probably damaging 1.00
R4467:Stat6 UTSW 10 127651228 missense probably damaging 1.00
R5346:Stat6 UTSW 10 127652313 missense probably benign 0.44
R5481:Stat6 UTSW 10 127647826 splice site probably null
R5722:Stat6 UTSW 10 127658373 missense probably benign 0.00
R6036:Stat6 UTSW 10 127655444 missense possibly damaging 0.58
R6036:Stat6 UTSW 10 127655444 missense possibly damaging 0.58
R6244:Stat6 UTSW 10 127657712 splice site probably null
R6914:Stat6 UTSW 10 127651262 missense probably damaging 1.00
R6942:Stat6 UTSW 10 127651262 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGCTGGCCTTTTCAGAC -3'
(R):5'- GCTGTAAATTTCACAGGTGAGAG -3'

Sequencing Primer
(F):5'- CAGACTGAATTTTCCTTTCTCGGAGG -3'
(R):5'- GGGCCTACACACATTATGAATTCGTG -3'
Posted On2018-11-06