Incidental Mutation 'R6937:Serpinb6a'
ID540355
Institutional Source Beutler Lab
Gene Symbol Serpinb6a
Ensembl Gene ENSMUSG00000060147
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6a
Synonymsovalbumin, D330015H01Rik, 4930482L21Rik, Spi3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6937 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location33917918-34002794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33918818 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 241 (I241V)
Ref Sequence ENSEMBL: ENSMUSP00000017188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017188] [ENSMUST00000043552] [ENSMUST00000076532] [ENSMUST00000167163] [ENSMUST00000167260] [ENSMUST00000168350] [ENSMUST00000171034] [ENSMUST00000171252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017188
AA Change: I241V

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000017188
Gene: ENSMUSG00000060147
AA Change: I241V

DomainStartEndE-ValueType
SERPIN 34 399 2.84e-179 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000043552
AA Change: I220V

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041016
Gene: ENSMUSG00000060147
AA Change: I220V

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000076532
AA Change: I220V

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147
AA Change: I220V

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167163
AA Change: I220V

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131115
Gene: ENSMUSG00000060147
AA Change: I220V

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167260
SMART Domains Protein: ENSMUSP00000127768
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 193 1.34e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168350
SMART Domains Protein: ENSMUSP00000130356
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 162 9.24e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171034
AA Change: I220V

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147
AA Change: I220V

DomainStartEndE-ValueType
SERPIN 13 228 3.54e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171252
SMART Domains Protein: ENSMUSP00000126162
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 188 4.71e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and developmentally normal, with no apparent alterations in growth, leukocyte function, or sensitivity to cerebral ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,387,020 V613A probably benign Het
Cdh23 A T 10: 60,487,114 L337Q probably damaging Het
Chrna6 A G 8: 27,407,027 L274P probably damaging Het
Ciita G A 16: 10,512,491 probably null Het
Csnka2ip A T 16: 64,478,695 probably benign Het
Ddx60 G A 8: 62,037,069 D1691N probably damaging Het
Dnah7b T C 1: 46,195,120 I1441T probably damaging Het
Dock4 T C 12: 40,834,635 S1713P probably benign Het
Ep400 T C 5: 110,711,152 probably benign Het
Epn1 T C 7: 5,089,944 I85T probably damaging Het
Eri2 T C 7: 119,786,789 K228E probably damaging Het
Garem1 C T 18: 21,147,770 A510T probably benign Het
Gfm2 T A 13: 97,163,064 probably null Het
Gm37596 T C 3: 93,692,216 N282S probably benign Het
Gm4858 A G 3: 93,074,110 H145R probably benign Het
Hnrnpd T C 5: 99,963,770 T321A probably benign Het
Htr2a A T 14: 74,645,164 I197F probably damaging Het
Krtap2-4 T A 11: 99,614,473 probably benign Het
Lcn3 C A 2: 25,767,811 Y179* probably null Het
Mak A T 13: 41,048,102 M261K probably damaging Het
March7 A G 2: 60,240,966 T605A probably damaging Het
Mcm4 A C 16: 15,636,335 F83V probably benign Het
Myo18b T C 5: 112,802,392 N1546S probably benign Het
Nckap1 T A 2: 80,508,716 K989N probably damaging Het
Ndufaf5 A G 2: 140,181,602 D119G probably damaging Het
Olfr846 A T 9: 19,360,689 V222D probably damaging Het
Pcdh1 T C 18: 38,203,475 T36A possibly damaging Het
Pitpna C T 11: 75,603,731 T100I possibly damaging Het
Pmf1 A T 3: 88,399,189 L102Q probably damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Robo3 A G 9: 37,429,880 L10P probably benign Het
St14 A T 9: 31,129,660 probably null Het
Stat6 T C 10: 127,658,702 probably null Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tgfbrap1 A T 1: 43,051,904 V687E probably damaging Het
Trim30d A T 7: 104,483,427 S68T probably damaging Het
Ttn A G 2: 76,832,909 probably benign Het
Ugt3a1 A T 15: 9,292,072 D97V probably benign Het
Ugt8a G A 3: 125,915,601 probably benign Het
Vmn1r184 A T 7: 26,267,325 K165N probably benign Het
Vmn2r86 T A 10: 130,448,654 I523F probably damaging Het
Wapl G A 14: 34,722,354 V588I probably benign Het
Wdr7 C T 18: 63,791,867 P974S probably benign Het
Zfp975 T C 7: 42,665,056 D31G possibly damaging Het
Other mutations in Serpinb6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Serpinb6a APN 13 33931512 missense possibly damaging 0.54
IGL01356:Serpinb6a APN 13 33925417 missense possibly damaging 0.76
IGL01458:Serpinb6a APN 13 33930081 missense possibly damaging 0.56
IGL01539:Serpinb6a APN 13 33930134 missense probably damaging 1.00
IGL02795:Serpinb6a APN 13 33931593 missense probably damaging 1.00
IGL02885:Serpinb6a APN 13 33918799 missense probably benign 0.11
IGL02971:Serpinb6a APN 13 33931470 critical splice donor site probably null
R0829:Serpinb6a UTSW 13 33935701 utr 5 prime probably benign
R1324:Serpinb6a UTSW 13 33918360 missense probably damaging 1.00
R2232:Serpinb6a UTSW 13 33925320 missense probably damaging 0.97
R3498:Serpinb6a UTSW 13 33918781 missense probably damaging 0.99
R4982:Serpinb6a UTSW 13 33918874 missense probably damaging 0.99
R5131:Serpinb6a UTSW 13 33918872 missense probably benign 0.42
R5132:Serpinb6a UTSW 13 33918322 missense probably benign 0.00
R6149:Serpinb6a UTSW 13 33918360 missense probably damaging 1.00
R6427:Serpinb6a UTSW 13 33918259 missense probably damaging 0.99
R7806:Serpinb6a UTSW 13 33935565 splice site probably null
R7830:Serpinb6a UTSW 13 33930047 missense probably benign 0.09
R7948:Serpinb6a UTSW 13 33923020 missense probably benign 0.00
R7949:Serpinb6a UTSW 13 33923020 missense probably benign 0.00
R8531:Serpinb6a UTSW 13 33931479 missense probably damaging 0.99
R8773:Serpinb6a UTSW 13 33931560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTAACCTATTATGATAGCTGGG -3'
(R):5'- TATGCCTAGTTTCAGTGCCTGG -3'

Sequencing Primer
(F):5'- AGTGTTTACTACGCATGCTCTAG -3'
(R):5'- GCTACTTTGGTTGAATTTGCCCAATG -3'
Posted On2018-11-06