Incidental Mutation 'R6937:Serpinb6a'
ID 540355
Institutional Source Beutler Lab
Gene Symbol Serpinb6a
Ensembl Gene ENSMUSG00000060147
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6a
Synonyms D330015H01Rik, ovalbumin, 4930482L21Rik, Spi3
MMRRC Submission 045051-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6937 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 34101901-34186777 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34102801 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 241 (I241V)
Ref Sequence ENSEMBL: ENSMUSP00000017188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017188] [ENSMUST00000043552] [ENSMUST00000076532] [ENSMUST00000167163] [ENSMUST00000167260] [ENSMUST00000168350] [ENSMUST00000171034] [ENSMUST00000171252]
AlphaFold Q60854
Predicted Effect possibly damaging
Transcript: ENSMUST00000017188
AA Change: I241V

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000017188
Gene: ENSMUSG00000060147
AA Change: I241V

DomainStartEndE-ValueType
SERPIN 34 399 2.84e-179 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000043552
AA Change: I220V

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041016
Gene: ENSMUSG00000060147
AA Change: I220V

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000076532
AA Change: I220V

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147
AA Change: I220V

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167163
AA Change: I220V

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131115
Gene: ENSMUSG00000060147
AA Change: I220V

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167260
SMART Domains Protein: ENSMUSP00000127768
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 193 1.34e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168350
SMART Domains Protein: ENSMUSP00000130356
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 162 9.24e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171034
AA Change: I220V

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147
AA Change: I220V

DomainStartEndE-ValueType
SERPIN 13 228 3.54e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171252
SMART Domains Protein: ENSMUSP00000126162
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 188 4.71e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and developmentally normal, with no apparent alterations in growth, leukocyte function, or sensitivity to cerebral ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd52 T C 10: 128,222,889 (GRCm39) V613A probably benign Het
Cdh23 A T 10: 60,322,893 (GRCm39) L337Q probably damaging Het
Chrna6 A G 8: 27,897,055 (GRCm39) L274P probably damaging Het
Ciita G A 16: 10,330,355 (GRCm39) probably null Het
Csnka2ip A T 16: 64,299,058 (GRCm39) probably benign Het
Ddx60 G A 8: 62,490,103 (GRCm39) D1691N probably damaging Het
Dnah7b T C 1: 46,234,280 (GRCm39) I1441T probably damaging Het
Dock4 T C 12: 40,884,634 (GRCm39) S1713P probably benign Het
Ep400 T C 5: 110,859,018 (GRCm39) probably benign Het
Epn1 T C 7: 5,092,943 (GRCm39) I85T probably damaging Het
Eri2 T C 7: 119,386,012 (GRCm39) K228E probably damaging Het
Garem1 C T 18: 21,280,827 (GRCm39) A510T probably benign Het
Gfm2 T A 13: 97,299,572 (GRCm39) probably null Het
Hnrnpd T C 5: 100,111,629 (GRCm39) T321A probably benign Het
Htr2a A T 14: 74,882,604 (GRCm39) I197F probably damaging Het
Krtap2-4 T A 11: 99,505,299 (GRCm39) probably benign Het
Lcn3 C A 2: 25,657,823 (GRCm39) Y179* probably null Het
Mak A T 13: 41,201,578 (GRCm39) M261K probably damaging Het
Marchf7 A G 2: 60,071,310 (GRCm39) T605A probably damaging Het
Mcm4 A C 16: 15,454,199 (GRCm39) F83V probably benign Het
Myo18b T C 5: 112,950,258 (GRCm39) N1546S probably benign Het
Nckap1 T A 2: 80,339,060 (GRCm39) K989N probably damaging Het
Ndufaf5 A G 2: 140,023,522 (GRCm39) D119G probably damaging Het
Or7g28 A T 9: 19,271,985 (GRCm39) V222D probably damaging Het
Pcdh1 T C 18: 38,336,528 (GRCm39) T36A possibly damaging Het
Pitpna C T 11: 75,494,557 (GRCm39) T100I possibly damaging Het
Pmf1 A T 3: 88,306,496 (GRCm39) L102Q probably damaging Het
Rftn2 T C 1: 55,233,508 (GRCm39) probably null Het
Robo3 A G 9: 37,341,176 (GRCm39) L10P probably benign Het
St14 A T 9: 31,040,956 (GRCm39) probably null Het
Stat6 T C 10: 127,494,571 (GRCm39) probably null Het
Tdpoz6 T C 3: 93,599,523 (GRCm39) N282S probably benign Het
Tdpoz8 A G 3: 92,981,417 (GRCm39) H145R probably benign Het
Tenm4 G A 7: 96,202,703 (GRCm39) R106H probably benign Het
Tgfbrap1 A T 1: 43,091,064 (GRCm39) V687E probably damaging Het
Trim30d A T 7: 104,132,634 (GRCm39) S68T probably damaging Het
Ttn A G 2: 76,663,253 (GRCm39) probably benign Het
Ugt3a1 A T 15: 9,292,158 (GRCm39) D97V probably benign Het
Ugt8a G A 3: 125,709,250 (GRCm39) probably benign Het
Vmn1r184 A T 7: 25,966,750 (GRCm39) K165N probably benign Het
Vmn2r86 T A 10: 130,284,523 (GRCm39) I523F probably damaging Het
Wapl G A 14: 34,444,311 (GRCm39) V588I probably benign Het
Wdr7 C T 18: 63,924,938 (GRCm39) P974S probably benign Het
Zfp975 T C 7: 42,314,480 (GRCm39) D31G possibly damaging Het
Other mutations in Serpinb6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Serpinb6a APN 13 34,115,495 (GRCm39) missense possibly damaging 0.54
IGL01356:Serpinb6a APN 13 34,109,400 (GRCm39) missense possibly damaging 0.76
IGL01458:Serpinb6a APN 13 34,114,064 (GRCm39) missense possibly damaging 0.56
IGL01539:Serpinb6a APN 13 34,114,117 (GRCm39) missense probably damaging 1.00
IGL02795:Serpinb6a APN 13 34,115,576 (GRCm39) missense probably damaging 1.00
IGL02885:Serpinb6a APN 13 34,102,782 (GRCm39) missense probably benign 0.11
IGL02971:Serpinb6a APN 13 34,115,453 (GRCm39) critical splice donor site probably null
R0829:Serpinb6a UTSW 13 34,119,684 (GRCm39) utr 5 prime probably benign
R1324:Serpinb6a UTSW 13 34,102,343 (GRCm39) missense probably damaging 1.00
R2232:Serpinb6a UTSW 13 34,109,303 (GRCm39) missense probably damaging 0.97
R3498:Serpinb6a UTSW 13 34,102,764 (GRCm39) missense probably damaging 0.99
R4982:Serpinb6a UTSW 13 34,102,857 (GRCm39) missense probably damaging 0.99
R5131:Serpinb6a UTSW 13 34,102,855 (GRCm39) missense probably benign 0.42
R5132:Serpinb6a UTSW 13 34,102,305 (GRCm39) missense probably benign 0.00
R6149:Serpinb6a UTSW 13 34,102,343 (GRCm39) missense probably damaging 1.00
R6427:Serpinb6a UTSW 13 34,102,242 (GRCm39) missense probably damaging 0.99
R7806:Serpinb6a UTSW 13 34,119,548 (GRCm39) splice site probably null
R7830:Serpinb6a UTSW 13 34,114,030 (GRCm39) missense probably benign 0.09
R7948:Serpinb6a UTSW 13 34,107,003 (GRCm39) missense probably benign 0.00
R7949:Serpinb6a UTSW 13 34,107,003 (GRCm39) missense probably benign 0.00
R8531:Serpinb6a UTSW 13 34,115,462 (GRCm39) missense probably damaging 0.99
R8773:Serpinb6a UTSW 13 34,115,543 (GRCm39) missense probably damaging 1.00
R9117:Serpinb6a UTSW 13 34,109,412 (GRCm39) missense probably benign 0.35
R9182:Serpinb6a UTSW 13 34,109,360 (GRCm39) missense probably damaging 1.00
R9565:Serpinb6a UTSW 13 34,102,400 (GRCm39) missense probably damaging 1.00
R9781:Serpinb6a UTSW 13 34,109,346 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGTAACCTATTATGATAGCTGGG -3'
(R):5'- TATGCCTAGTTTCAGTGCCTGG -3'

Sequencing Primer
(F):5'- AGTGTTTACTACGCATGCTCTAG -3'
(R):5'- GCTACTTTGGTTGAATTTGCCCAATG -3'
Posted On 2018-11-06